EMAIL THIS PAGE TO A FRIEND

KCNG3

potassium voltage-gated channel, subfamily G, member 3

Synonyms: KV10.1 KV6.3
UniProtKB ID: Q8TAE7, Q53SC1
Gene ID:
Human(170850) Summary: Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a gamma subunit functioning as a modulatory molecule. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(225030) potassium voltage-gated channel, subfamily G, member 3
Rat(171011) potassium voltage-gated channel, subfamily G, member 3
Zebrafish(565643) potassium voltage-gated channel, subfamily G, member 3
chicken(421393) potassium voltage-gated channel, subfamily G, member 3
domestic cat(101094090) potassium voltage-gated channel, subfamily G, member 3
dog(483049) potassium voltage-gated channel, subfamily G, member 3
sheep(101115443) potassium voltage-gated channel, subfamily G, member 3
Domestic Rabbit(100357812) potassium voltage-gated channel, subfamily G, member 3
domestic guinea pig(100724213) potassium voltage-gated channel, subfamily G, member 3
naked mole-rat(101716780) potassium voltage-gated channel, subfamily G, member 3
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133329 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040881 MISSION® esiRNA esiRNA human KCNG3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133329 Rosetta Predictions human pricing
NM_172344 Rosetta Predictions human pricing
NM_001033957 Rosetta Predictions rat pricing
NM_133426 Rosetta Predictions rat pricing
NM_153512 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219002 predicted 1833
2 SASI_Hs01_00219003 predicted 1551
3 SASI_Hs01_00219004 predicted 1894
4 SASI_Hs01_00219005 predicted 1824
5 SASI_Hs01_00219006 predicted 1502
6 SASI_Hs01_00219008 predicted 1817
7 SASI_Hs01_00219009 predicted 1602
8 SASI_Hs01_00219010 predicted 1926
9 SASI_Hs01_00219011 predicted 867
10 SASI_Hs02_00363000 predicted 1996
11 SASI_Hs01_00219007 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225015 predicted 1802
2 SASI_Hs01_00225016 predicted 1516
3 SASI_Hs01_00225017 predicted 1860
4 SASI_Hs01_00225018 predicted 1791
5 SASI_Hs01_00225019 predicted 1473
6 SASI_Hs01_00225021 predicted 1790
7 SASI_Hs01_00225022 predicted 1574
8 SASI_Hs01_00225023 predicted 1891
9 SASI_Hs01_00225024 predicted 866
10 SASI_Hs02_00367988 predicted 1969
11 SASI_Hs01_00225020 predicted 1895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033957 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067254 predicted 1185
2 SASI_Rn01_00067255 predicted 1259
3 SASI_Rn01_00067256 predicted 1312
4 SASI_Rn01_00067257 predicted 303
5 SASI_Rn01_00067258 predicted 1196
6 SASI_Rn01_00067259 predicted 1234
7 SASI_Rn01_00067261 predicted 1301
8 SASI_Rn01_00067262 predicted 319
9 SASI_Rn02_00203834 predicted 1318
10 SASI_Rn01_00067263 predicted 1278
11 SASI_Rn01_00067260 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084444 predicted 1223
2 SASI_Rn01_00084445 predicted 1285
3 SASI_Rn01_00084446 predicted 1347
4 SASI_Rn01_00084447 predicted 298
5 SASI_Rn01_00084448 predicted 1230
6 SASI_Rn01_00084449 predicted 1267
7 SASI_Rn01_00084451 predicted 1334
8 SASI_Rn01_00084452 predicted 316
9 SASI_Rn02_00267684 predicted 1352
10 SASI_Rn01_00084453 predicted 1305
11 SASI_Rn01_00084450 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183826 predicted 1518
2 SASI_Mm01_00183827 predicted 1624
3 SASI_Mm01_00183828 predicted 1457
4 SASI_Mm01_00183829 predicted 1040
5 SASI_Mm01_00183832 predicted 1070
6 SASI_Mm01_00183833 predicted 1464
7 SASI_Mm01_00183834 predicted 925
8 SASI_Mm01_00183835 predicted 1357
9 SASI_Mm02_00343261 predicted 1600
10 SASI_Mm02_00343262 predicted 1081
11 SASI_Mm01_00183830 predicted 1055
12 SASI_Mm01_00183831 predicted 1677
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153512
KCNG3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily G, member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153512.1-2043s21c1
Sequence:CCGGGCCACATGTGGGAACTGTTTACTCGAGTAAACAGTTCCCACATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153512.1-1706s21c1
Sequence:CCGGTTCCCAACTCAAGGGTTAAAGCTCGAGCTTTAACCCTTGAGTTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153512.1-3016s1c1
Sequence:CCGGGCTGGAAACTTAGCCTCCTTTCTCGAGAAAGGAGGCTAAGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1525s1c1
Sequence:CCGGCAAGTTTAGATCGGCTAGATACTCGAGTATCTAGCCGATCTAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-550s1c1
Sequence:CCGGGCTCTCCTTCTACAACGAGATCTCGAGATCTCGTTGTAGAAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1478s1c1
Sequence:CCGGCCCATCACTTTCATCTACCATCTCGAGATGGTAGATGAAAGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1058s1c1
Sequence:CCGGCCCTATTACATCTCTGTGCTACTCGAGTAGCACAGAGATGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153512
KCNG3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily G, member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153512.1-2043s21c1
Sequence:CCGGGCCACATGTGGGAACTGTTTACTCGAGTAAACAGTTCCCACATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153512.1-1706s21c1
Sequence:CCGGTTCCCAACTCAAGGGTTAAAGCTCGAGCTTTAACCCTTGAGTTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153512.1-3016s1c1
Sequence:CCGGGCTGGAAACTTAGCCTCCTTTCTCGAGAAAGGAGGCTAAGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1525s1c1
Sequence:CCGGCAAGTTTAGATCGGCTAGATACTCGAGTATCTAGCCGATCTAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-550s1c1
Sequence:CCGGGCTCTCCTTCTACAACGAGATCTCGAGATCTCGTTGTAGAAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1478s1c1
Sequence:CCGGCCCATCACTTTCATCTACCATCTCGAGATGGTAGATGAAAGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1058s1c1
Sequence:CCGGCCCTATTACATCTCTGTGCTACTCGAGTAGCACAGAGATGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153512
KCNG3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily G, member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436924    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153512.1-2043s21c1
Sequence:CCGGGCCACATGTGGGAACTGTTTACTCGAGTAAACAGTTCCCACATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153512.1-1706s21c1
Sequence:CCGGTTCCCAACTCAAGGGTTAAAGCTCGAGCTTTAACCCTTGAGTTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153512.1-3016s1c1
Sequence:CCGGGCTGGAAACTTAGCCTCCTTTCTCGAGAAAGGAGGCTAAGTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1525s1c1
Sequence:CCGGCAAGTTTAGATCGGCTAGATACTCGAGTATCTAGCCGATCTAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-550s1c1
Sequence:CCGGGCTCTCCTTCTACAACGAGATCTCGAGATCTCGTTGTAGAAGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1478s1c1
Sequence:CCGGCCCATCACTTTCATCTACCATCTCGAGATGGTAGATGAAAGTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153512.1-1058s1c1
Sequence:CCGGCCCTATTACATCTCTGTGCTACTCGAGTAGCACAGAGATGTAATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133329
KCNG3 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily G, member 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133329.4-1785s21c1
Sequence:CCGGGGAATTGTTCTATTGGCATTACTCGAGTAATGCCAATAGAACAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133329.4-1300s21c1
Sequence:CCGGAGTGCATCGTGAGGTTCATTGCTCGAGCAATGAACCTCACGATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133329.4-1948s21c1
Sequence:CCGGCTTTGATGCTGCTTCATATTTCTCGAGAAATATGAAGCAGCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133329.4-2006s21c1
Sequence:CCGGTCATCATCTTGGTAGGGTAAACTCGAGTTTACCCTACCAAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1255s1c1
Sequence:CCGGCCTCCGGGATAATTGAAGCTACTCGAGTAGCTTCAATTATCCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1720s1c1
Sequence:CCGGGCTATGGAGATATGTATCCTACTCGAGTAGGATACATATCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1464s1c1
Sequence:CCGGGTACTTAGAATGATGAGGATTCTCGAGAATCCTCATCATTCTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1385s1c1
Sequence:CCGGGCCGTATTACATCTCTGTGTTCTCGAGAACACAGAGATGTAATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1835s1c1
Sequence:CCGGGCAGTGTTATCATGAGCTCAACTCGAGTTGAGCTCATGATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133329
KCNG3 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily G, member 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133329.4-1785s21c1
Sequence:CCGGGGAATTGTTCTATTGGCATTACTCGAGTAATGCCAATAGAACAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133329.4-1300s21c1
Sequence:CCGGAGTGCATCGTGAGGTTCATTGCTCGAGCAATGAACCTCACGATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133329.4-1948s21c1
Sequence:CCGGCTTTGATGCTGCTTCATATTTCTCGAGAAATATGAAGCAGCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133329.4-2006s21c1
Sequence:CCGGTCATCATCTTGGTAGGGTAAACTCGAGTTTACCCTACCAAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1255s1c1
Sequence:CCGGCCTCCGGGATAATTGAAGCTACTCGAGTAGCTTCAATTATCCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1720s1c1
Sequence:CCGGGCTATGGAGATATGTATCCTACTCGAGTAGGATACATATCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1464s1c1
Sequence:CCGGGTACTTAGAATGATGAGGATTCTCGAGAATCCTCATCATTCTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1385s1c1
Sequence:CCGGGCCGTATTACATCTCTGTGTTCTCGAGAACACAGAGATGTAATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1835s1c1
Sequence:CCGGGCAGTGTTATCATGAGCTCAACTCGAGTTGAGCTCATGATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133329
KCNG3 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily G, member 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133329.4-1785s21c1
Sequence:CCGGGGAATTGTTCTATTGGCATTACTCGAGTAATGCCAATAGAACAATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133329.4-1300s21c1
Sequence:CCGGAGTGCATCGTGAGGTTCATTGCTCGAGCAATGAACCTCACGATGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133329.4-1948s21c1
Sequence:CCGGCTTTGATGCTGCTTCATATTTCTCGAGAAATATGAAGCAGCATCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133329.4-2006s21c1
Sequence:CCGGTCATCATCTTGGTAGGGTAAACTCGAGTTTACCCTACCAAGATGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1255s1c1
Sequence:CCGGCCTCCGGGATAATTGAAGCTACTCGAGTAGCTTCAATTATCCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1720s1c1
Sequence:CCGGGCTATGGAGATATGTATCCTACTCGAGTAGGATACATATCTCCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1464s1c1
Sequence:CCGGGTACTTAGAATGATGAGGATTCTCGAGAATCCTCATCATTCTAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1385s1c1
Sequence:CCGGGCCGTATTACATCTCTGTGTTCTCGAGAACACAGAGATGTAATACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133329.4-1835s1c1
Sequence:CCGGGCAGTGTTATCATGAGCTCAACTCGAGTTGAGCTCATGATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks