EMAIL THIS PAGE TO A FRIEND

KCNH2

potassium voltage-gated channel, subfamily H (eag-related), member 2

Synonyms: ERG1 HERG HERG1 Kv11.1 LQT2 SQT1
Gene ID:
Human(3757) Summary: This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(16511) potassium voltage-gated channel, subfamily H (eag-related), member 2
Rat(117018) potassium voltage-gated channel, subfamily H (eag-related), member 2
Zebrafish(405763) potassium voltage-gated channel, subfamily H (eag-related), member 2
domestic cat(101081621) potassium voltage-gated channel, subfamily H (eag-related), member 2
cow(539971) potassium voltage-gated channel, subfamily H (eag-related), member 2
Horse(100064000) potassium voltage-gated channel, subfamily H (eag-related), member 2
dog(403761) potassium voltage-gated channel, subfamily H (eag-related), member 2
domestic guinea pig(100135563) potassium voltage-gated channel, subfamily H (eag-related), member 2
naked mole-rat(101711977) potassium voltage-gated channel, subfamily H (eag-related), member 2
Domestic Rabbit(100009242) potassium voltage-gated channel, subfamily H (eag-related), member 2
139 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T9652 Terfenadine human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000238 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013569 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013569 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013569 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080951 MISSION® esiRNA esiRNA human KCNH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000238 Rosetta Predictions human pricing
NM_172056 Rosetta Predictions human pricing
NM_172057 Rosetta Predictions human pricing
NM_053949 Rosetta Predictions rat pricing
NM_013569 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235096 predicted 1561
2 SASI_Hs01_00235097 predicted 1428
3 SASI_Hs01_00235098 predicted 1539
4 SASI_Hs01_00235099 predicted 1819
5 SASI_Hs01_00235100 predicted 1618
6 SASI_Hs01_00235101 predicted 1769
7 SASI_Hs01_00235102 predicted 1906
8 SASI_Hs01_00235103 predicted 1766
9 SASI_Hs01_00235104 predicted 1558
10 SASI_Hs01_00235105 predicted 1944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367779 predicted 1560
2 SASI_Hs01_00221635 predicted 1421
3 SASI_Hs02_00367780 predicted 1535
4 SASI_Hs01_00221637 predicted 1819
5 SASI_Hs01_00221641 predicted 1614
6 SASI_Hs02_00367781 predicted 1769
7 SASI_Hs02_00367782 predicted 1909
8 SASI_Hs02_00367783 predicted 1769
9 SASI_Hs02_00367784 predicted 1557
10 SASI_Hs02_00367785 predicted 1946
11 SASI_Hs01_00221632 predicted 325
12 SASI_Hs01_00221633 predicted 1088
13 SASI_Hs01_00221634 predicted 1083
14 SASI_Hs01_00221636 predicted 1028
15 SASI_Hs01_00221638 predicted 301
16 SASI_Hs01_00221639 predicted 1030
17 SASI_Hs01_00221640 predicted 1339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172057 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088674 predicted 851
2 SASI_Hs01_00088675 predicted 717
3 SASI_Hs01_00088676 predicted 832
4 SASI_Hs01_00088677 predicted 1117
5 SASI_Hs01_00088678 predicted 905
6 SASI_Hs01_00088679 predicted 1062
7 SASI_Hs01_00088680 predicted 1200
8 SASI_Hs01_00088682 predicted 1055
9 SASI_Hs01_00088683 predicted 847
10 SASI_Hs02_00367786 predicted 1232
11 SASI_Hs01_00088681 predicted 2696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050797 predicted 2635
2 SASI_Rn01_00050798 predicted 1009
3 SASI_Rn01_00050799 predicted 2182
4 SASI_Rn01_00050801 predicted 850
5 SASI_Rn01_00050802 predicted 2926
6 SASI_Rn01_00050803 predicted 1986
7 SASI_Rn01_00050804 predicted 1069
8 SASI_Rn01_00050806 predicted 2322
9 SASI_Rn02_00266907 predicted 2622
10 SASI_Rn02_00266908 predicted 2494
11 SASI_Rn01_00050800 predicted 1315
12 SASI_Rn01_00050805 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013569 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176620 predicted 2755
2 SASI_Mm01_00176621 predicted 2259
3 SASI_Mm01_00176622 predicted 1391
4 SASI_Mm01_00176623 predicted 1292
5 SASI_Mm01_00176624 predicted 1084
6 SASI_Mm01_00176625 predicted 2944
7 SASI_Mm01_00176626 predicted 1627
8 SASI_Mm01_00176628 predicted 1331
9 SASI_Mm01_00176629 predicted 2824
10 SASI_Mm02_00322308 predicted 2500
11 SASI_Mm01_00176627 predicted 2601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000238
KCNH2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000238.2-3320s21c1
Sequence:CCGGCTCACCTTGGACTCGCTTTCTCTCGAGAGAAAGCGAGTCCAAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000238.2-1787s21c1
Sequence:CCGGCAGATAGGCAAACCCTACAACCTCGAGGTTGTAGGGTTTGCCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000238.2-3726s21c1
Sequence:CCGGGAGGGCATTAGCTGGTCTAACCTCGAGGTTAGACCAGCTAATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-2596s1c1
Sequence:CCGGCCTGCGAGATACCAACATGATCTCGAGATCATGTTGGTATCTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-91s1c1
Sequence:CCGGCCGTAAGTTCATCATCGCCAACTCGAGTTGGCGATGATGAACTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-1078s1c1
Sequence:CCGGCCGTGAGATCATAGCACCTAACTCGAGTTAGGTGCTATGATCTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-289s1c1
Sequence:CCGGCAAAGTGGAAATCGCCTTCTACTCGAGTAGAAGGCGATTTCCACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-1960s1c1
Sequence:CCGGCCTCATGTATGCTAGCATCTTCTCGAGAAGATGCTAGCATACATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000238
KCNH2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000238.2-3320s21c1
Sequence:CCGGCTCACCTTGGACTCGCTTTCTCTCGAGAGAAAGCGAGTCCAAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000238.2-1787s21c1
Sequence:CCGGCAGATAGGCAAACCCTACAACCTCGAGGTTGTAGGGTTTGCCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000238.2-3726s21c1
Sequence:CCGGGAGGGCATTAGCTGGTCTAACCTCGAGGTTAGACCAGCTAATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-2596s1c1
Sequence:CCGGCCTGCGAGATACCAACATGATCTCGAGATCATGTTGGTATCTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-91s1c1
Sequence:CCGGCCGTAAGTTCATCATCGCCAACTCGAGTTGGCGATGATGAACTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-1078s1c1
Sequence:CCGGCCGTGAGATCATAGCACCTAACTCGAGTTAGGTGCTATGATCTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-289s1c1
Sequence:CCGGCAAAGTGGAAATCGCCTTCTACTCGAGTAGAAGGCGATTTCCACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-1960s1c1
Sequence:CCGGCCTCATGTATGCTAGCATCTTCTCGAGAAGATGCTAGCATACATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000238
KCNH2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000238.2-3320s21c1
Sequence:CCGGCTCACCTTGGACTCGCTTTCTCTCGAGAGAAAGCGAGTCCAAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000238.2-1787s21c1
Sequence:CCGGCAGATAGGCAAACCCTACAACCTCGAGGTTGTAGGGTTTGCCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422341    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000238.2-3726s21c1
Sequence:CCGGGAGGGCATTAGCTGGTCTAACCTCGAGGTTAGACCAGCTAATGCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-2596s1c1
Sequence:CCGGCCTGCGAGATACCAACATGATCTCGAGATCATGTTGGTATCTCGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-91s1c1
Sequence:CCGGCCGTAAGTTCATCATCGCCAACTCGAGTTGGCGATGATGAACTTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-1078s1c1
Sequence:CCGGCCGTGAGATCATAGCACCTAACTCGAGTTAGGTGCTATGATCTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-289s1c1
Sequence:CCGGCAAAGTGGAAATCGCCTTCTACTCGAGTAGAAGGCGATTTCCACTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000238.2-1960s1c1
Sequence:CCGGCCTCATGTATGCTAGCATCTTCTCGAGAAGATGCTAGCATACATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013569
KCNH2 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, subfamily H (eag-related), member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-405s1c1
Sequence:CCGGCCGCAAGTTCATCATCGCTAACTCGAGTTAGCGATGATGAACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2146s1c1
Sequence:CCGGCCCTCCATCAAGGACAAGTATCTCGAGATACTTGTCCTTGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-705s1c1
Sequence:CCGGCCTCAACTTTGAAGTAGTGATCTCGAGATCACTACTTCAAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2821s1c1
Sequence:CCGGCTGCACAAGATCCATCGTGATCTCGAGATCACGATGGATCTTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2916s1c1
Sequence:CCGGCCTTCGAGATACCAACATGATCTCGAGATCATGTTGGTATCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013569
KCNH2 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, subfamily H (eag-related), member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-405s1c1
Sequence:CCGGCCGCAAGTTCATCATCGCTAACTCGAGTTAGCGATGATGAACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2146s1c1
Sequence:CCGGCCCTCCATCAAGGACAAGTATCTCGAGATACTTGTCCTTGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-705s1c1
Sequence:CCGGCCTCAACTTTGAAGTAGTGATCTCGAGATCACTACTTCAAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2821s1c1
Sequence:CCGGCTGCACAAGATCCATCGTGATCTCGAGATCACGATGGATCTTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2916s1c1
Sequence:CCGGCCTTCGAGATACCAACATGATCTCGAGATCATGTTGGTATCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013569
KCNH2 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, subfamily H (eag-related), member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-405s1c1
Sequence:CCGGCCGCAAGTTCATCATCGCTAACTCGAGTTAGCGATGATGAACTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2146s1c1
Sequence:CCGGCCCTCCATCAAGGACAAGTATCTCGAGATACTTGTCCTTGATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-705s1c1
Sequence:CCGGCCTCAACTTTGAAGTAGTGATCTCGAGATCACTACTTCAAAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2821s1c1
Sequence:CCGGCTGCACAAGATCCATCGTGATCTCGAGATCACGATGGATCTTGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013569.1-2916s1c1
Sequence:CCGGCCTTCGAGATACCAACATGATCTCGAGATCATGTTGGTATCTCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks