EMAIL THIS PAGE TO A FRIEND

KCNIP1

Kv channel interacting protein 1

Synonyms: KCHIP1 VABP
UniProtKB ID: Q9NZI2, B7Z7B4, Q3YAD2, Q5U822
Gene ID:
Human(30820) Summary: This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
Mouse(70357) Kv channel-interacting protein 1
Rat(65023) Kv channel-interacting protein 1
sheep(101105527) Kv channel interacting protein 1
domestic guinea pig(100719432) Kv channel interacting protein 1
naked mole-rat(101704389) Kv channel interacting protein 1
chicken(416173) Kv channel interacting protein 1
dog(489125) Kv channel interacting protein 1
cow(541458) Kv channel interacting protein 1
domestic cat(101095884) Kv channel interacting protein 1
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027398 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027398 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027398 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014592 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043931 MISSION® esiRNA esiRNA human KCNIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034837 Rosetta Predictions human pricing
NM_001034838 Rosetta Predictions human pricing
NM_014592 Rosetta Predictions human pricing
NM_022929 Rosetta Predictions rat pricing
NM_027398 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154191 predicted 1433
2 SASI_Hs01_00154192 predicted 939
3 SASI_Hs01_00154193 predicted 1511
4 SASI_Hs01_00154194 predicted 1421
5 SASI_Hs01_00154195 predicted 1001
6 SASI_Hs01_00154196 predicted 1241
7 SASI_Hs01_00154197 predicted 1125
8 SASI_Hs01_00154198 predicted 1502
9 SASI_Hs01_00154199 predicted 886
10 SASI_Hs01_00154200 predicted 1373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015298 predicted 893
2 SASI_Hs01_00015299 predicted 403
3 SASI_Hs01_00015300 predicted 974
4 SASI_Hs01_00015301 predicted 886
5 SASI_Hs01_00015302 predicted 468
6 SASI_Hs01_00015303 predicted 700
7 SASI_Hs01_00015304 predicted 592
8 SASI_Hs01_00015305 predicted 963
9 SASI_Hs01_00015306 predicted 351
10 SASI_Hs01_00015307 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106132 predicted 1398
2 SASI_Hs01_00106133 predicted 907
3 SASI_Hs01_00106134 predicted 1474
4 SASI_Hs01_00106135 predicted 1393
5 SASI_Hs01_00106136 predicted 970
6 SASI_Hs01_00106137 predicted 1204
7 SASI_Hs01_00106138 predicted 1091
8 SASI_Hs01_00106139 predicted 1465
9 SASI_Hs01_00106140 predicted 850
10 SASI_Hs01_00106141 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022929 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069397 predicted 352
2 SASI_Rn01_00069398 predicted 296
3 SASI_Rn01_00069400 predicted 254
4 SASI_Rn02_00263622 predicted 407
5 SASI_Rn02_00263623 predicted 326
6 SASI_Rn01_00069402 predicted 375
7 SASI_Rn01_00069403 predicted 374
8 SASI_Rn01_00069404 predicted 256
9 SASI_Rn01_00069405 predicted 200
10 SASI_Rn01_00069406 predicted 383
11 SASI_Rn01_00069399 predicted 315
12 SASI_Rn01_00069401 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183021 predicted 763
2 SASI_Mm01_00183022 predicted 707
3 SASI_Mm01_00183023 predicted 891
4 SASI_Mm01_00183024 predicted 903
5 SASI_Mm01_00183025 predicted 650
6 SASI_Mm01_00183026 predicted 776
7 SASI_Mm01_00183027 predicted 1002
8 SASI_Mm01_00183028 predicted 384
9 SASI_Mm01_00183029 predicted 1280
10 SASI_Mm01_00183030 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027398
KCNIP1 MISSION shRNA Bacterial Glycerol Stock
Kv channel interacting protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027398.2-1009s1c1
Sequence:CCGGGCTCTCAGAGACACTGACAAACTCGAGTTTGTCAGTGTCTCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-386s1c1
Sequence:CCGGCGACCCTCTAAAGACAAGATTCTCGAGAATCTTGTCTTTAGAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-896s1c1
Sequence:CCGGGATGGCATTGTAACGTTAGATCTCGAGATCTAACGTTACAATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-649s1c1
Sequence:CCGGCTCTGTAAAGTTCGAGGACTTCTCGAGAAGTCCTCGAACTTTACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-757s1c1
Sequence:CCGGCTACATAAACAAAGAGGAGATCTCGAGATCTCCTCTTTGTTTATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027398.2-587s21c1
Sequence:CCGGCACGGAGATGCCAGCACATATCTCGAGATATGTGCTGGCATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027398.2-715s21c1
Sequence:CCGGACTAAGGTGGACGTTTAATTTCTCGAGAAATTAAACGTCCACCTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027398
KCNIP1 MISSION shRNA shRNA Plasmid DNA
Kv channel interacting protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027398.2-1009s1c1
Sequence:CCGGGCTCTCAGAGACACTGACAAACTCGAGTTTGTCAGTGTCTCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-386s1c1
Sequence:CCGGCGACCCTCTAAAGACAAGATTCTCGAGAATCTTGTCTTTAGAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-896s1c1
Sequence:CCGGGATGGCATTGTAACGTTAGATCTCGAGATCTAACGTTACAATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-649s1c1
Sequence:CCGGCTCTGTAAAGTTCGAGGACTTCTCGAGAAGTCCTCGAACTTTACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-757s1c1
Sequence:CCGGCTACATAAACAAAGAGGAGATCTCGAGATCTCCTCTTTGTTTATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027398.2-587s21c1
Sequence:CCGGCACGGAGATGCCAGCACATATCTCGAGATATGTGCTGGCATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027398.2-715s21c1
Sequence:CCGGACTAAGGTGGACGTTTAATTTCTCGAGAAATTAAACGTCCACCTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027398
KCNIP1 MISSION shRNA Lentiviral Transduction Particles
Kv channel interacting protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027398.2-1009s1c1
Sequence:CCGGGCTCTCAGAGACACTGACAAACTCGAGTTTGTCAGTGTCTCTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-386s1c1
Sequence:CCGGCGACCCTCTAAAGACAAGATTCTCGAGAATCTTGTCTTTAGAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-896s1c1
Sequence:CCGGGATGGCATTGTAACGTTAGATCTCGAGATCTAACGTTACAATGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-649s1c1
Sequence:CCGGCTCTGTAAAGTTCGAGGACTTCTCGAGAAGTCCTCGAACTTTACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027398.2-757s1c1
Sequence:CCGGCTACATAAACAAAGAGGAGATCTCGAGATCTCCTCTTTGTTTATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027398.2-587s21c1
Sequence:CCGGCACGGAGATGCCAGCACATATCTCGAGATATGTGCTGGCATCTCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027398.2-715s21c1
Sequence:CCGGACTAAGGTGGACGTTTAATTTCTCGAGAAATTAAACGTCCACCTTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014592
KCNIP1 MISSION shRNA Bacterial Glycerol Stock
Kv channel interacting protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-901s1c1
Sequence:CCGGCGAGAAACTAAGGTGGACATTCTCGAGAATGTCCACCTTAGTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-581s1c1
Sequence:CCGGCCCTCGAAAGATAAGATTGAACTCGAGTTCAATCTTATCTTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-802s1c1
Sequence:CCGGCCATTACCTCTTCAATGCCTTCTCGAGAAGGCATTGAAGAGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-1092s1c1
Sequence:CCGGGCATCGTAACTTTAGATGAATCTCGAGATTCATCTAAAGTTACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-739s1c1
Sequence:CCGGCGAAGACACATTCAAGCAGATCTCGAGATCTGCTTGAATGTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1217s21c1
Sequence:CCGGGTACTAAACAACCACCTTAACCTCGAGGTTAAGGTGGTTGTTTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1463s21c1
Sequence:CCGGGGTCCCTCTGCTTAAGCTTAACTCGAGTTAAGCTTAAGCAGAGGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014592.2-975s21c1
Sequence:CCGGACATTGTCAAAGCCATCTATGCTCGAGCATAGATGGCTTTGACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1243s21c1
Sequence:CCGGGATCTGCCCTTGTTCTGATTTCTCGAGAAATCAGAACAAGGGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014592
KCNIP1 MISSION shRNA shRNA Plasmid DNA
Kv channel interacting protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-901s1c1
Sequence:CCGGCGAGAAACTAAGGTGGACATTCTCGAGAATGTCCACCTTAGTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-581s1c1
Sequence:CCGGCCCTCGAAAGATAAGATTGAACTCGAGTTCAATCTTATCTTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-802s1c1
Sequence:CCGGCCATTACCTCTTCAATGCCTTCTCGAGAAGGCATTGAAGAGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-1092s1c1
Sequence:CCGGGCATCGTAACTTTAGATGAATCTCGAGATTCATCTAAAGTTACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-739s1c1
Sequence:CCGGCGAAGACACATTCAAGCAGATCTCGAGATCTGCTTGAATGTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1217s21c1
Sequence:CCGGGTACTAAACAACCACCTTAACCTCGAGGTTAAGGTGGTTGTTTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1463s21c1
Sequence:CCGGGGTCCCTCTGCTTAAGCTTAACTCGAGTTAAGCTTAAGCAGAGGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014592.2-975s21c1
Sequence:CCGGACATTGTCAAAGCCATCTATGCTCGAGCATAGATGGCTTTGACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1243s21c1
Sequence:CCGGGATCTGCCCTTGTTCTGATTTCTCGAGAAATCAGAACAAGGGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014592
KCNIP1 MISSION shRNA Lentiviral Transduction Particles
Kv channel interacting protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-901s1c1
Sequence:CCGGCGAGAAACTAAGGTGGACATTCTCGAGAATGTCCACCTTAGTTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-581s1c1
Sequence:CCGGCCCTCGAAAGATAAGATTGAACTCGAGTTCAATCTTATCTTTCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-802s1c1
Sequence:CCGGCCATTACCTCTTCAATGCCTTCTCGAGAAGGCATTGAAGAGGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-1092s1c1
Sequence:CCGGGCATCGTAACTTTAGATGAATCTCGAGATTCATCTAAAGTTACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014592.2-739s1c1
Sequence:CCGGCGAAGACACATTCAAGCAGATCTCGAGATCTGCTTGAATGTGTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1217s21c1
Sequence:CCGGGTACTAAACAACCACCTTAACCTCGAGGTTAAGGTGGTTGTTTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420709    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1463s21c1
Sequence:CCGGGGTCCCTCTGCTTAAGCTTAACTCGAGTTAAGCTTAAGCAGAGGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014592.2-975s21c1
Sequence:CCGGACATTGTCAAAGCCATCTATGCTCGAGCATAGATGGCTTTGACAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014592.2-1243s21c1
Sequence:CCGGGATCTGCCCTTGTTCTGATTTCTCGAGAAATCAGAACAAGGGCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks