EMAIL THIS PAGE TO A FRIEND

KCNJ13

potassium inwardly-rectifying channel, subfamily J, member 13

Synonyms: KIR1.4 KIR7.1 LCA16 SVD
UniProtKB ID: O60928, A0PGH1, O76023, Q53SA1, Q8N3Y4
Gene ID:
Human(3769) Summary: This gene encodes a member of the inwardly rectifying potassium channel family of proteins. Members of this family form ion channel pores that allow potassium ions to pass into a cell. The encoded protein belongs to a subfamily of low signal channel conductance proteins that have a low dependence on potassium concentration. Mutations in this gene are associated with snowflake vitreoretinal degeneration. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
Mouse(100040591) potassium inwardly-rectifying channel, subfamily J, member 13
Rat(94341) potassium inwardly-rectifying channel, subfamily J, member 13
sheep(101105861) potassium inwardly-rectifying channel, subfamily J, member 13
domestic guinea pig(100379277) potassium inwardly-rectifying channel, subfamily J, member 13
naked mole-rat(101708530) potassium inwardly-rectifying channel, subfamily J, member 13
Zebrafish(555691) potassium inwardly-rectifying channel, subfamily J, member 13
domestic cat(101099825) potassium inwardly-rectifying channel, subfamily J, member 13
cow(512288) potassium inwardly-rectifying channel, subfamily J, member 13
Horse(100057299) potassium inwardly-rectifying channel, subfamily J, member 13
dog(477411) potassium inwardly-rectifying channel, subfamily J, member 13
chicken(101669621) potassium inwardly-rectifying channel, subfamily J, member 13
chicken(101749520) potassium inwardly-rectifying channel, subfamily J, member 13
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002242 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002242 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002242 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001110227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001110227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001110227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002242 Rosetta Predictions human pricing
NM_053608 Rosetta Predictions rat pricing
NM_001110227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103684 predicted 924
2 SASI_Hs01_00103685 predicted 195
3 SASI_Hs01_00103686 predicted 537
4 SASI_Hs01_00103687 predicted 372
5 SASI_Hs01_00103688 predicted 492
6 SASI_Hs01_00103689 predicted 1009
7 SASI_Hs01_00103690 predicted 1195
8 SASI_Hs01_00103691 predicted 1186
9 SASI_Hs01_00103692 predicted 920
10 SASI_Hs01_00103693 predicted 1165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053608 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266309 predicted 847
2 SASI_Rn01_00112671 predicted 580
3 SASI_Rn02_00266310 predicted 404
4 SASI_Rn01_00112673 predicted 521
5 SASI_Rn01_00112674 predicted 841
6 SASI_Rn01_00112675 predicted 795
7 SASI_Rn01_00112676 predicted 1000
8 SASI_Rn01_00112677 predicted 983
9 SASI_Rn01_00112678 predicted 208
10 SASI_Rn01_00112679 predicted 901
11 SASI_Rn01_00112672 predicted 466
12 SASI_Rn01_00112680 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305046 predicted 598
2 SASI_Mm02_00305047 predicted 539
3 SASI_Mm02_00305048 predicted 497
4 SASI_Mm02_00305049 predicted 859
5 SASI_Mm02_00305050 predicted 484
6 SASI_Mm02_00305051 predicted 1018
7 SASI_Mm02_00305052 predicted 476
8 SASI_Mm02_00305053 predicted 914
9 SASI_Mm02_00305054 predicted 1001
10 SASI_Mm02_00305055 predicted 983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002242
KCNJ13 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 13
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-422s1c1
Sequence:CCGGCCACACTATCTGTGTCAAGTACTCGAGTACTTGACACAGATAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-1048s1c1
Sequence:CCGGCCCGAGGTTCCAAATGTGAATCTCGAGATTCACATTTGGAACCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-542s1c1
Sequence:CCGGCGCCTTACTTGCCATACAAATCTCGAGATTTGTATGGCAAGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-921s1c1
Sequence:CCGGCCTTCTCACTTTGAATTAGTTCTCGAGAACTAATTCAAAGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002242.4-1213s21c1
Sequence:CCGGCAGAATAAGACTTATCCATTTCTCGAGAAATGGATAAGTCTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002242
KCNJ13 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 13
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-422s1c1
Sequence:CCGGCCACACTATCTGTGTCAAGTACTCGAGTACTTGACACAGATAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-1048s1c1
Sequence:CCGGCCCGAGGTTCCAAATGTGAATCTCGAGATTCACATTTGGAACCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-542s1c1
Sequence:CCGGCGCCTTACTTGCCATACAAATCTCGAGATTTGTATGGCAAGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-921s1c1
Sequence:CCGGCCTTCTCACTTTGAATTAGTTCTCGAGAACTAATTCAAAGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002242.4-1213s21c1
Sequence:CCGGCAGAATAAGACTTATCCATTTCTCGAGAAATGGATAAGTCTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002242
KCNJ13 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 13
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-422s1c1
Sequence:CCGGCCACACTATCTGTGTCAAGTACTCGAGTACTTGACACAGATAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-1048s1c1
Sequence:CCGGCCCGAGGTTCCAAATGTGAATCTCGAGATTCACATTTGGAACCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-542s1c1
Sequence:CCGGCGCCTTACTTGCCATACAAATCTCGAGATTTGTATGGCAAGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002242.2-921s1c1
Sequence:CCGGCCTTCTCACTTTGAATTAGTTCTCGAGAACTAATTCAAAGTGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002242.4-1213s21c1
Sequence:CCGGCAGAATAAGACTTATCCATTTCTCGAGAAATGGATAAGTCTTATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001110227
KCNJ13 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-1011s21c1
Sequence:CCGGATCATGTTACATCACCGATTTCTCGAGAAATCGGTGATGTAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-480s21c1
Sequence:CCGGACACAACTTACAATTGGTTATCTCGAGATAACCAATTGTAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-539s21c1
Sequence:CCGGCGCCTTACTTGCCATACAAATCTCGAGATTTGTATGGCAAGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-855s21c1
Sequence:CCGGCTAACCTATTACCATACTATCCTCGAGGATAGTATGGTAATAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-1136s21c1
Sequence:CCGGACACAGGACTGACCTAGATATCTCGAGATATCTAGGTCAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001110227
KCNJ13 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-1011s21c1
Sequence:CCGGATCATGTTACATCACCGATTTCTCGAGAAATCGGTGATGTAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-480s21c1
Sequence:CCGGACACAACTTACAATTGGTTATCTCGAGATAACCAATTGTAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-539s21c1
Sequence:CCGGCGCCTTACTTGCCATACAAATCTCGAGATTTGTATGGCAAGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-855s21c1
Sequence:CCGGCTAACCTATTACCATACTATCCTCGAGGATAGTATGGTAATAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-1136s21c1
Sequence:CCGGACACAGGACTGACCTAGATATCTCGAGATATCTAGGTCAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001110227
KCNJ13 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-1011s21c1
Sequence:CCGGATCATGTTACATCACCGATTTCTCGAGAAATCGGTGATGTAACATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-480s21c1
Sequence:CCGGACACAACTTACAATTGGTTATCTCGAGATAACCAATTGTAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-539s21c1
Sequence:CCGGCGCCTTACTTGCCATACAAATCTCGAGATTTGTATGGCAAGTAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-855s21c1
Sequence:CCGGCTAACCTATTACCATACTATCCTCGAGGATAGTATGGTAATAGGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001110227.1-1136s21c1
Sequence:CCGGACACAGGACTGACCTAGATATCTCGAGATATCTAGGTCAGTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks