EMAIL THIS PAGE TO A FRIEND

KCNJ6

potassium inwardly-rectifying channel, subfamily J, member 6

Synonyms: BIR1 GIRK-2 GIRK2 KATP-2 KATP2 KCNJ7 KIR3.2 hiGIRK2
UniProtKB ID: P48051, Q3MJ74, Q53WW6
Gene ID:
Human(3763) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and may be involved in the regulation of insulin secretion by glucose. It associates with two other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
Mouse(16522) potassium inwardly-rectifying channel, subfamily J, member 6
Rat(25743) potassium inwardly-rectifying channel, subfamily J, member 6
sheep(101117719) potassium inwardly-rectifying channel, subfamily J, member 6
domestic guinea pig(100714547) potassium inwardly-rectifying channel, subfamily J, member 6
naked mole-rat(101719327) potassium inwardly-rectifying channel, subfamily J, member 6
Zebrafish(569498) potassium inwardly-rectifying channel, subfamily J, member 6
cow(520743) potassium inwardly-rectifying channel, subfamily J, member 6
Horse(100060665) potassium inwardly-rectifying channel, subfamily J, member 6
domestic cat(101080818) potassium inwardly-rectifying channel, subfamily J, member 6
dog(487756) potassium inwardly-rectifying channel, subfamily J, member 6
chicken(427983) potassium inwardly-rectifying channel, subfamily J, member 6
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002240 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002240 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002240 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002240 Rosetta Predictions human pricing
NM_013192 Rosetta Predictions rat pricing
NM_001025584 Rosetta Predictions mouse pricing
NM_001025585 Rosetta Predictions mouse pricing
NM_001025590 Rosetta Predictions mouse pricing
NM_010606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155619 predicted 766
2 SASI_Hs01_00155620 predicted 1304
3 SASI_Hs01_00155621 predicted 803
4 SASI_Hs01_00155622 predicted 1297
5 SASI_Hs02_00333483 predicted 1362
6 SASI_Hs02_00333484 predicted 1019
7 SASI_Hs01_00155624 predicted 1206
8 SASI_Hs01_00155625 predicted 1305
9 SASI_Hs02_00333485 predicted 1364
10 SASI_Hs01_00155628 predicted 633
11 SASI_Hs01_00155623 predicted 1039
12 SASI_Hs01_00155626 predicted 981
13 SASI_Hs01_00155627 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013192 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261043 predicted 1463
2 SASI_Rn02_00261044 predicted 1244
3 SASI_Rn02_00261045 predicted 472
4 SASI_Rn02_00261046 predicted 706
5 SASI_Rn02_00261047 predicted 479
6 SASI_Rn02_00261048 predicted 1434
7 SASI_Rn02_00261049 predicted 658
8 SASI_Rn02_00261050 predicted 983
9 SASI_Rn02_00261051 predicted 305
10 SASI_Rn02_00261052 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025584 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111824 predicted 978
2 SASI_Mm01_00111825 predicted 782
3 SASI_Mm01_00111826 predicted 796
4 SASI_Mm01_00111827 predicted 1203
5 SASI_Mm01_00111828 predicted 1075
6 SASI_Mm01_00111829 predicted 920
7 SASI_Mm01_00111830 predicted 1159
8 SASI_Mm01_00111831 predicted 1245
9 SASI_Mm01_00111832 predicted 1250
10 SASI_Mm01_00111833 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025585 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164481 predicted 977
2 SASI_Mm01_00164482 predicted 783
3 SASI_Mm01_00164483 predicted 797
4 SASI_Mm01_00164484 predicted 1207
5 SASI_Mm01_00164485 predicted 1080
6 SASI_Mm01_00164486 predicted 921
7 SASI_Mm01_00164487 predicted 1153
8 SASI_Mm01_00164488 predicted 1244
9 SASI_Mm01_00164489 predicted 1252
10 SASI_Mm01_00164490 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140277 predicted 653
2 SASI_Mm01_00140278 predicted 465
3 SASI_Mm01_00140279 predicted 477
4 SASI_Mm01_00140280 predicted 878
5 SASI_Mm01_00140281 predicted 753
6 SASI_Mm01_00140282 predicted 592
7 SASI_Mm01_00140283 predicted 835
8 SASI_Mm01_00140284 predicted 919
9 SASI_Mm01_00140285 predicted 929
10 SASI_Mm01_00140286 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075402 predicted 978
2 SASI_Mm02_00318921 predicted 787
3 SASI_Mm01_00075404 predicted 799
4 SASI_Mm02_00318922 predicted 1203
5 SASI_Mm02_00318923 predicted 1075
6 SASI_Mm02_00318924 predicted 920
7 SASI_Mm02_00318925 predicted 1152
8 SASI_Mm02_00318926 predicted 1244
9 SASI_Mm02_00318927 predicted 1253
10 SASI_Mm01_00075408 predicted 881
11 SASI_Mm01_00075401 predicted 1790
12 SASI_Mm01_00075403 predicted 1572
13 SASI_Mm01_00075405 predicted 546
14 SASI_Mm01_00075406 predicted 1506
15 SASI_Mm01_00075407 predicted 556
16 SASI_Mm01_00075409 predicted 1763
17 SASI_Mm01_00075410 predicted 1693
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010606
KCNJ6 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1312s1c1
Sequence:CCGGCCATTGATTATTAGCCATGAACTCGAGTTCATGGCTAATAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1201s1c1
Sequence:CCGGGCCAAGTTGATCAAGTCCAAACTCGAGTTTGGACTTGATCAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1723s1c1
Sequence:CCGGGACGTGGCAAACCTAGAGAATCTCGAGATTCTCTAGGTTTGCCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-512s1c1
Sequence:CCGGCTAACGTCTTGGAAGGCGATTCTCGAGAATCGCCTTCCAAGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1032s1c1
Sequence:CCGGCGCCTTCATGGTAGGATGTATCTCGAGATACATCCTACCATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010606
KCNJ6 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1312s1c1
Sequence:CCGGCCATTGATTATTAGCCATGAACTCGAGTTCATGGCTAATAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1201s1c1
Sequence:CCGGGCCAAGTTGATCAAGTCCAAACTCGAGTTTGGACTTGATCAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1723s1c1
Sequence:CCGGGACGTGGCAAACCTAGAGAATCTCGAGATTCTCTAGGTTTGCCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-512s1c1
Sequence:CCGGCTAACGTCTTGGAAGGCGATTCTCGAGAATCGCCTTCCAAGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1032s1c1
Sequence:CCGGCGCCTTCATGGTAGGATGTATCTCGAGATACATCCTACCATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010606
KCNJ6 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1312s1c1
Sequence:CCGGCCATTGATTATTAGCCATGAACTCGAGTTCATGGCTAATAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1201s1c1
Sequence:CCGGGCCAAGTTGATCAAGTCCAAACTCGAGTTTGGACTTGATCAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1723s1c1
Sequence:CCGGGACGTGGCAAACCTAGAGAATCTCGAGATTCTCTAGGTTTGCCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-512s1c1
Sequence:CCGGCTAACGTCTTGGAAGGCGATTCTCGAGAATCGCCTTCCAAGACGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010606.1-1032s1c1
Sequence:CCGGCGCCTTCATGGTAGGATGTATCTCGAGATACATCCTACCATGAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002240
KCNJ6 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1365s1c1
Sequence:CCGGGCTGATCATTAGCCATGAAATCTCGAGATTTCATGGCTAATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1578s1c1
Sequence:CCGGCGAAGTTGACTACAACAGCTTCTCGAGAAGCTGTTGTAGTCAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1033s1c1
Sequence:CCGGGAGGGAATTATTCTTCTCTTACTCGAGTAAGAGAAGAATAATTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-801s1c1
Sequence:CCGGGTGGAGATTCAACCTATTGATCTCGAGATCAATAGGTTGAATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1774s1c1
Sequence:CCGGGATGTGGCAAACCTGGAGAATCTCGAGATTCTCCAGGTTTGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002240.2-2174s21c1
Sequence:CCGGCAAGGTTTCTGGTGCCTATTTCTCGAGAAATAGGCACCAGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002240.2-1247s21c1
Sequence:CCGGTCAGAGCCAAGTTGATCAAATCTCGAGATTTGATCAACTTGGCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002240
KCNJ6 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1365s1c1
Sequence:CCGGGCTGATCATTAGCCATGAAATCTCGAGATTTCATGGCTAATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1578s1c1
Sequence:CCGGCGAAGTTGACTACAACAGCTTCTCGAGAAGCTGTTGTAGTCAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1033s1c1
Sequence:CCGGGAGGGAATTATTCTTCTCTTACTCGAGTAAGAGAAGAATAATTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-801s1c1
Sequence:CCGGGTGGAGATTCAACCTATTGATCTCGAGATCAATAGGTTGAATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1774s1c1
Sequence:CCGGGATGTGGCAAACCTGGAGAATCTCGAGATTCTCCAGGTTTGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002240.2-2174s21c1
Sequence:CCGGCAAGGTTTCTGGTGCCTATTTCTCGAGAAATAGGCACCAGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002240.2-1247s21c1
Sequence:CCGGTCAGAGCCAAGTTGATCAAATCTCGAGATTTGATCAACTTGGCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002240
KCNJ6 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1365s1c1
Sequence:CCGGGCTGATCATTAGCCATGAAATCTCGAGATTTCATGGCTAATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1578s1c1
Sequence:CCGGCGAAGTTGACTACAACAGCTTCTCGAGAAGCTGTTGTAGTCAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1033s1c1
Sequence:CCGGGAGGGAATTATTCTTCTCTTACTCGAGTAAGAGAAGAATAATTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-801s1c1
Sequence:CCGGGTGGAGATTCAACCTATTGATCTCGAGATCAATAGGTTGAATCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002240.2-1774s1c1
Sequence:CCGGGATGTGGCAAACCTGGAGAATCTCGAGATTCTCCAGGTTTGCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002240.2-2174s21c1
Sequence:CCGGCAAGGTTTCTGGTGCCTATTTCTCGAGAAATAGGCACCAGAAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002240.2-1247s21c1
Sequence:CCGGTCAGAGCCAAGTTGATCAAATCTCGAGATTTGATCAACTTGGCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks