EMAIL THIS PAGE TO A FRIEND

KCNJ9

potassium inwardly-rectifying channel, subfamily J, member 9

Synonyms: GIRK3 KIR3.3
UniProtKB ID: Q92806, Q5JW75
Gene ID:
Human(3765) Summary: Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. It associates with another G-protein-activated potassium channel to form a heteromultimeric pore-forming complex. [provided by RefSeq, Jul 2008]
Mouse(16524) potassium inwardly-rectifying channel, subfamily J, member 9
Rat(116560) potassium inwardly-rectifying channel, subfamily J, member 9
sheep(101102032) potassium inwardly-rectifying channel, subfamily J, member 9
domestic guinea pig(100729246) potassium inwardly-rectifying channel, subfamily J, member 9
naked mole-rat(101722613) potassium inwardly-rectifying channel, subfamily J, member 9
cow(614969) potassium inwardly-rectifying channel, subfamily J, member 9
domestic cat(101091342) potassium inwardly-rectifying channel, subfamily J, member 9
dog(100855823) potassium inwardly-rectifying channel, subfamily J, member 9
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004983 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004983 Rosetta Predictions human pricing
NM_053834 Rosetta Predictions rat pricing
NM_008429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106458 predicted 1045
2 SASI_Hs01_00106459 predicted 810
3 SASI_Hs01_00106460 predicted 862
4 SASI_Hs01_00106461 predicted 1051
5 SASI_Hs01_00106462 predicted 814
6 SASI_Hs01_00106464 predicted 715
7 SASI_Hs01_00106465 predicted 833
8 SASI_Hs01_00106466 predicted 820
9 SASI_Hs01_00106467 predicted 1041
10 SASI_Hs02_00338693 predicted 957
11 SASI_Hs01_00106463 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266670 predicted 1411
2 SASI_Rn02_00266671 predicted 597
3 SASI_Rn02_00266672 predicted 870
4 SASI_Rn02_00266673 predicted 1732
5 SASI_Rn02_00266674 predicted 382
6 SASI_Rn02_00266675 predicted 1556
7 SASI_Rn02_00266676 predicted 1875
8 SASI_Rn02_00266677 predicted 620
9 SASI_Rn02_00266678 predicted 1363
10 SASI_Rn02_00266679 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068365 predicted 982
2 SASI_Mm01_00068366 predicted 1126
3 SASI_Mm01_00068369 predicted 1796
4 SASI_Mm01_00068368 predicted 1419
5 SASI_Mm01_00068370 predicted 881
6 SASI_Mm01_00068371 predicted 371
7 SASI_Mm02_00313899 predicted 1160
8 SASI_Mm01_00068373 predicted 1416
9 SASI_Mm01_00068374 predicted 1872
10 SASI_Mm02_00313900 predicted 1130
11 SASI_Mm01_00068367 predicted 1800
12 SASI_Mm01_00068372 predicted 1800
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008429
KCNJ9 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 9
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-601s1c1
Sequence:CCGGCCCGTGCGTCAACAACCTCAACTCGAGTTGAGGTTGTTGACGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1112s1c1
Sequence:CCGGGACTTCGAGATCGTAGTCATTCTCGAGAATGACTACGATCTCGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1265s1c1
Sequence:CCGGGCCAGCTTCCACGAAACCTTTCTCGAGAAAGGTTTCGTGGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008429.1-1850s1c1
Sequence:CCGGGCAGCACACCTTTGTGAGAAACTCGAGTTTCTCACAAAGGTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1039s1c1
Sequence:CCGGTCTCGTCATCAGCCACGAAATCTCGAGATTTCGTGGCTGATGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008429.2-1132s21c1
Sequence:CCGGTCGTACCTGGTGGATGAAGTGCTCGAGCACTTCATCCACCAGGTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008429.2-1533s21c1
Sequence:CCGGTGTCCCGAGGAACAGCTAAAGCTCGAGCTTTAGCTGTTCCTCGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008429.2-1383s21c1
Sequence:CCGGAGCTGACAAGGAGCACAATGGCTCGAGCCATTGTGCTCCTTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008429
KCNJ9 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 9
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-601s1c1
Sequence:CCGGCCCGTGCGTCAACAACCTCAACTCGAGTTGAGGTTGTTGACGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1112s1c1
Sequence:CCGGGACTTCGAGATCGTAGTCATTCTCGAGAATGACTACGATCTCGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1265s1c1
Sequence:CCGGGCCAGCTTCCACGAAACCTTTCTCGAGAAAGGTTTCGTGGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008429.1-1850s1c1
Sequence:CCGGGCAGCACACCTTTGTGAGAAACTCGAGTTTCTCACAAAGGTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1039s1c1
Sequence:CCGGTCTCGTCATCAGCCACGAAATCTCGAGATTTCGTGGCTGATGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008429.2-1132s21c1
Sequence:CCGGTCGTACCTGGTGGATGAAGTGCTCGAGCACTTCATCCACCAGGTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008429.2-1533s21c1
Sequence:CCGGTGTCCCGAGGAACAGCTAAAGCTCGAGCTTTAGCTGTTCCTCGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008429.2-1383s21c1
Sequence:CCGGAGCTGACAAGGAGCACAATGGCTCGAGCCATTGTGCTCCTTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008429
KCNJ9 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 9
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-601s1c1
Sequence:CCGGCCCGTGCGTCAACAACCTCAACTCGAGTTGAGGTTGTTGACGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1112s1c1
Sequence:CCGGGACTTCGAGATCGTAGTCATTCTCGAGAATGACTACGATCTCGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1265s1c1
Sequence:CCGGGCCAGCTTCCACGAAACCTTTCTCGAGAAAGGTTTCGTGGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008429.1-1850s1c1
Sequence:CCGGGCAGCACACCTTTGTGAGAAACTCGAGTTTCTCACAAAGGTGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008429.1-1039s1c1
Sequence:CCGGTCTCGTCATCAGCCACGAAATCTCGAGATTTCGTGGCTGATGACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008429.2-1132s21c1
Sequence:CCGGTCGTACCTGGTGGATGAAGTGCTCGAGCACTTCATCCACCAGGTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426532    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008429.2-1533s21c1
Sequence:CCGGTGTCCCGAGGAACAGCTAAAGCTCGAGCTTTAGCTGTTCCTCGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008429.2-1383s21c1
Sequence:CCGGAGCTGACAAGGAGCACAATGGCTCGAGCCATTGTGCTCCTTGTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004983
KCNJ9 MISSION shRNA Bacterial Glycerol Stock
potassium inwardly-rectifying channel, subfamily J, member 9
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-1046s1c1
Sequence:CCGGCGACTTCGAGATCGTCGTTATCTCGAGATAACGACGATCTCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-1188s1c1
Sequence:CCGGGAAGTGGACTATGCCAGCTTTCTCGAGAAAGCTGGCATAGTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-716s1c1
Sequence:CCGGCGTCAAGATCTCGCAGCCCAACTCGAGTTGGGCTGCGAGATCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-353s1c1
Sequence:CCGGCGTGCGCGAGACATACCGCTACTCGAGTAGCGGTATGTCTCGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004983.2-1089s21c1
Sequence:CCGGACGGGAATGACATGCCAAGCTCTCGAGAGCTTGGCATGTCATTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004983.2-1760s21c1
Sequence:CCGGCATAGATGGACCAGTAGACAACTCGAGTTGTCTACTGGTCCATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004983
KCNJ9 MISSION shRNA shRNA Plasmid DNA
potassium inwardly-rectifying channel, subfamily J, member 9
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-1046s1c1
Sequence:CCGGCGACTTCGAGATCGTCGTTATCTCGAGATAACGACGATCTCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-1188s1c1
Sequence:CCGGGAAGTGGACTATGCCAGCTTTCTCGAGAAAGCTGGCATAGTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-716s1c1
Sequence:CCGGCGTCAAGATCTCGCAGCCCAACTCGAGTTGGGCTGCGAGATCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-353s1c1
Sequence:CCGGCGTGCGCGAGACATACCGCTACTCGAGTAGCGGTATGTCTCGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004983.2-1089s21c1
Sequence:CCGGACGGGAATGACATGCCAAGCTCTCGAGAGCTTGGCATGTCATTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004983.2-1760s21c1
Sequence:CCGGCATAGATGGACCAGTAGACAACTCGAGTTGTCTACTGGTCCATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004983
KCNJ9 MISSION shRNA Lentiviral Transduction Particles
potassium inwardly-rectifying channel, subfamily J, member 9
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-1046s1c1
Sequence:CCGGCGACTTCGAGATCGTCGTTATCTCGAGATAACGACGATCTCGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-1188s1c1
Sequence:CCGGGAAGTGGACTATGCCAGCTTTCTCGAGAAAGCTGGCATAGTCCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-716s1c1
Sequence:CCGGCGTCAAGATCTCGCAGCCCAACTCGAGTTGGGCTGCGAGATCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004983.2-353s1c1
Sequence:CCGGCGTGCGCGAGACATACCGCTACTCGAGTAGCGGTATGTCTCGCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004983.2-1089s21c1
Sequence:CCGGACGGGAATGACATGCCAAGCTCTCGAGAGCTTGGCATGTCATTCCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004983.2-1760s21c1
Sequence:CCGGCATAGATGGACCAGTAGACAACTCGAGTTGTCTACTGGTCCATCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks