EMAIL THIS PAGE TO A FRIEND

KCNK1

potassium channel, subfamily K, member 1

Synonyms: DPK HOHO K2P1 K2p1.1 KCNO1 TWIK-1 TWIK1
UniProtKB ID: O00180, Q13307, Q5T5E8
Gene ID:
Human(3775) Summary: This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]
Mouse(16525) potassium channel, subfamily K, member 1
Rat(59324) potassium channel, subfamily K, member 1
chicken(421519) potassium channel, subfamily K, member 1
cow(505563) potassium channel, subfamily K, member 1
domestic cat(101087524) potassium channel, subfamily K, member 1
dog(488965) potassium channel, subfamily K, member 1
domestic guinea pig(100135567) potassium channel, subfamily K, member 1
naked mole-rat(101703396) potassium channel, subfamily K, member 1
sheep(101115679) potassium channel, subfamily K, member 1
Domestic Rabbit(100008962) potassium channel, subfamily K, member 1
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002245 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002245 Rosetta Predictions human pricing
NM_021688 Rosetta Predictions rat pricing
NM_008430 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050450 predicted 559
2 SASI_Hs01_00050451 predicted 1074
3 SASI_Hs01_00050452 predicted 1057
4 SASI_Hs01_00050453 predicted 903
5 SASI_Hs01_00050455 predicted 1072
6 SASI_Hs01_00050456 predicted 947
7 SASI_Hs01_00050457 predicted 485
8 SASI_Hs01_00050458 predicted 932
9 SASI_Hs01_00050459 predicted 956
10 SASI_Hs02_00333488 predicted 921
11 SASI_Hs01_00050454 predicted 811
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262715 predicted 1206
2 SASI_Rn02_00262716 predicted 1324
3 SASI_Rn02_00262717 predicted 1221
4 SASI_Rn01_00073426 predicted 427
5 SASI_Rn01_00073427 predicted 1196
6 SASI_Rn01_00073430 predicted 1368
7 SASI_Rn01_00073431 predicted 1249
8 SASI_Rn01_00073425 predicted 1270
9 SASI_Rn01_00073428 predicted 1239
10 SASI_Rn01_00073429 predicted 1073
11 SASI_Rn01_00073432 predicted 1338
12 SASI_Rn01_00073433 predicted 1017
13 SASI_Rn01_00073434 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022216 predicted 1189
2 SASI_Mm01_00022217 predicted 630
3 SASI_Mm01_00022219 predicted 762
4 SASI_Mm01_00022221 predicted 903
5 SASI_Mm02_00313901 predicted 1678
6 SASI_Mm01_00022222 predicted 644
7 SASI_Mm01_00022223 predicted 822
8 SASI_Mm01_00022225 predicted 436
9 SASI_Mm02_00313902 predicted 885
10 SASI_Mm02_00313903 predicted 1103
11 SASI_Mm01_00022218 predicted 628
12 SASI_Mm01_00022220 predicted 919
13 SASI_Mm01_00022224 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002245
VALIDATED
KCNK1 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002245.3-508s21c1
Sequence:CCGGGTGCTCTCCACCACAGGTTATCTCGAGATAACCTGTGGTGGAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-1179s21c1
Sequence:CCGGAGCGTAGGATTTGTTGCATTACTCGAGTAATGCAACAAATCCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-1430s21c1
Sequence:CCGGCGACCTTACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-890s21c1
Sequence:CCGGTCAGAGAGCTCTATAAGATTGCTCGAGCAATCTTATAGAGCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002245.3-569s21c1
Sequence:CCGGGCATCATCTACTCCGTCATTGCTCGAGCAATGACGGAGTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002245.2-1444s1c1
Sequence:CCGGCGACCTTACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002245.2-1056s1c1
Sequence:CCGGCACATCATAGAGCATGACCAACTCGAGTTGGTCATGCTCTATGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-804s1c1
Sequence:CCGGGATGACTGGAACTTCCTGGAACTCGAGTTCCAGGAAGTTCCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-554s1c1
Sequence:CCGGGCCCTTGTCAGATGGAGGTAACTCGAGTTACCTCCATCTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-944s1c1
Sequence:CCGGACTTGGCCTTATTGCCATGTTCTCGAGAACATGGCAATAAGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002245
VALIDATED
KCNK1 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002245.3-508s21c1
Sequence:CCGGGTGCTCTCCACCACAGGTTATCTCGAGATAACCTGTGGTGGAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-1179s21c1
Sequence:CCGGAGCGTAGGATTTGTTGCATTACTCGAGTAATGCAACAAATCCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-1430s21c1
Sequence:CCGGCGACCTTACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-890s21c1
Sequence:CCGGTCAGAGAGCTCTATAAGATTGCTCGAGCAATCTTATAGAGCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002245.3-569s21c1
Sequence:CCGGGCATCATCTACTCCGTCATTGCTCGAGCAATGACGGAGTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002245.2-1444s1c1
Sequence:CCGGCGACCTTACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002245.2-1056s1c1
Sequence:CCGGCACATCATAGAGCATGACCAACTCGAGTTGGTCATGCTCTATGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-804s1c1
Sequence:CCGGGATGACTGGAACTTCCTGGAACTCGAGTTCCAGGAAGTTCCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-554s1c1
Sequence:CCGGGCCCTTGTCAGATGGAGGTAACTCGAGTTACCTCCATCTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-944s1c1
Sequence:CCGGACTTGGCCTTATTGCCATGTTCTCGAGAACATGGCAATAAGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002245
VALIDATED
KCNK1 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002245.3-508s21c1
Sequence:CCGGGTGCTCTCCACCACAGGTTATCTCGAGATAACCTGTGGTGGAGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-1179s21c1
Sequence:CCGGAGCGTAGGATTTGTTGCATTACTCGAGTAATGCAACAAATCCTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-1430s21c1
Sequence:CCGGCGACCTTACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002245.3-890s21c1
Sequence:CCGGTCAGAGAGCTCTATAAGATTGCTCGAGCAATCTTATAGAGCTCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002245.3-569s21c1
Sequence:CCGGGCATCATCTACTCCGTCATTGCTCGAGCAATGACGGAGTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002245.2-1444s1c1
Sequence:CCGGCGACCTTACATAGGAGGAGAACTCGAGTTCTCCTCCTATGTAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_002245.2-1056s1c1
Sequence:CCGGCACATCATAGAGCATGACCAACTCGAGTTGGTCATGCTCTATGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-804s1c1
Sequence:CCGGGATGACTGGAACTTCCTGGAACTCGAGTTCCAGGAAGTTCCAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-554s1c1
Sequence:CCGGGCCCTTGTCAGATGGAGGTAACTCGAGTTACCTCCATCTGACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002245.2-944s1c1
Sequence:CCGGACTTGGCCTTATTGCCATGTTCTCGAGAACATGGCAATAAGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008430
KCNK1 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008430.1-1932s1c1
Sequence:CCGGGCCTAACAAACTCAAGAGAAACTCGAGTTTCTCTTGAGTTTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-1232s1c1
Sequence:CCGGGCAGAAGCAAAGTGAGCCTTTCTCGAGAAAGGCTCACTTTGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-680s1c1
Sequence:CCGGCAAAGCCTTCTGCATCATCTACTCGAGTAGATGATGCAGAAGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-857s1c1
Sequence:CCGGTGTCACCGTTTCCTGCTTCTTCTCGAGAAGAAGCAGGAAACGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-1106s1c1
Sequence:CCGGGCTGAAGAAGTTCAGGAAGATCTCGAGATCTTCCTGAACTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008430
KCNK1 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008430.1-1932s1c1
Sequence:CCGGGCCTAACAAACTCAAGAGAAACTCGAGTTTCTCTTGAGTTTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-1232s1c1
Sequence:CCGGGCAGAAGCAAAGTGAGCCTTTCTCGAGAAAGGCTCACTTTGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-680s1c1
Sequence:CCGGCAAAGCCTTCTGCATCATCTACTCGAGTAGATGATGCAGAAGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-857s1c1
Sequence:CCGGTGTCACCGTTTCCTGCTTCTTCTCGAGAAGAAGCAGGAAACGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-1106s1c1
Sequence:CCGGGCTGAAGAAGTTCAGGAAGATCTCGAGATCTTCCTGAACTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008430
KCNK1 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069898    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008430.1-1932s1c1
Sequence:CCGGGCCTAACAAACTCAAGAGAAACTCGAGTTTCTCTTGAGTTTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-1232s1c1
Sequence:CCGGGCAGAAGCAAAGTGAGCCTTTCTCGAGAAAGGCTCACTTTGCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-680s1c1
Sequence:CCGGCAAAGCCTTCTGCATCATCTACTCGAGTAGATGATGCAGAAGGCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-857s1c1
Sequence:CCGGTGTCACCGTTTCCTGCTTCTTCTCGAGAAGAAGCAGGAAACGGTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008430.1-1106s1c1
Sequence:CCGGGCTGAAGAAGTTCAGGAAGATCTCGAGATCTTCCTGAACTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks