EMAIL THIS PAGE TO A FRIEND

KCNK3

potassium channel, subfamily K, member 3

Synonyms: K2p3.1 OAT1 PPH4 TASK TASK-1 TBAK1
UniProtKB ID: O14649, Q53SU2
Gene ID:
Human(3777) Summary: This gene encodes a member of the superfamily of potassium channel proteins that contain two pore-forming P domains. The encoded protein is an outwardly rectifying channel that is sensitive to changes in extracellular pH and is inhibited by extracellular acidification. Also referred to as an acid-sensitive potassium channel, it is activated by the anesthetics halothane and isoflurane. Although three transcripts are detected in northern blots, there is currently no sequence available to confirm transcript variants for this gene. [provided by RefSeq, Aug 2008]
Mouse(16527) potassium channel, subfamily K, member 3
Rat(29553) potassium channel, subfamily K, member 3
Zebrafish(561866) potassium channel, subfamily K, member 3
dog(483002) potassium channel, subfamily K, member 3
cow(519188) potassium channel, subfamily K, member 3
domestic cat(101082745) potassium channel, subfamily K, member 3
sheep(100141302) potassium channel, subfamily K, member 3
domestic guinea pig(100724671) potassium channel, subfamily K, member 3
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301621 Anti-KCNK3 affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
AV35090 Anti-KCNK3 antibody produced in rabbit IgG fraction of antiserum guinea pig, human, mouse, rabbit, bovine, canine, rabbit, sheep, rat
western blot pricing
HPA026658 Anti-KCNK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
P0981 Anti-Potassium Channel TASK-1 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, rat
western blot pricing
SAB5201653 Monoclonal Anti-Task1 Potassium Channel - Alkaline Phosphatase antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201654 Monoclonal Anti-Task1 Potassium Channel - Apc antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201645 Monoclonal Anti-Task1 Potassium Channel - Atto 390 antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201646 Monoclonal Anti-Task1 Potassium Channel - Atto 488 antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201647 Monoclonal Anti-Task1 Potassium Channel - Atto 565 antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201648 Monoclonal Anti-Task1 Potassium Channel - Atto 594 antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201649 Monoclonal Anti-Task1 Potassium Channel - Atto 633 antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201650 Monoclonal Anti-Task1 Potassium Channel - Atto 655 antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201651 Monoclonal Anti-Task1 Potassium Channel - Atto 680 antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201652 Monoclonal Anti-Task1 Potassium Channel - Atto 700 antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201655 Monoclonal Anti-Task1 Potassium Channel - Biotin antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201656 Monoclonal Anti-Task1 Potassium Channel - Fitc antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201657 Monoclonal Anti-Task1 Potassium Channel - Hrp antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201658 Monoclonal Anti-Task1 Potassium Channel - Pe/Atto 594 antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201659 Monoclonal Anti-Task1 Potassium Channel - Percp antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201660 Monoclonal Anti-Task1 Potassium Channel - Rpe antibody produced in mouse clone S374-48, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201661 Monoclonal Anti-Task1 Potassium Channel - Streptavidin antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201644 Monoclonal Anti-Task1 Potassium Channel antibody produced in mouse clone S374-48, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002246 Rosetta Predictions human pricing
NM_033376 Rosetta Predictions rat pricing
NM_010608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108786 predicted 1662
2 SASI_Hs01_00108787 predicted 730
3 SASI_Hs01_00108788 predicted 1512
4 SASI_Hs01_00108789 predicted 511
5 SASI_Hs01_00108790 predicted 599
6 SASI_Hs02_00333489 predicted 1399
7 SASI_Hs01_00108791 predicted 1799
8 SASI_Hs01_00108793 predicted 1231
9 SASI_Hs02_00333490 predicted 776
10 SASI_Hs01_00108794 predicted 1075
11 SASI_Hs01_00108792 predicted 1672
12 SASI_Hs01_00108795 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058904 predicted 648
2 SASI_Rn01_00058905 predicted 376
3 SASI_Rn01_00058906 predicted 708
4 SASI_Rn01_00058907 predicted 365
5 SASI_Rn01_00058908 predicted 586
6 SASI_Rn01_00058909 predicted 838
7 SASI_Rn02_00265551 predicted 1256
8 SASI_Rn01_00058910 predicted 1051
9 SASI_Rn01_00058911 predicted 1060
10 SASI_Rn01_00058912 predicted 574
11 SASI_Rn01_00058913 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044763 predicted 697
2 SASI_Mm01_00044764 predicted 696
3 SASI_Mm01_00044765 predicted 754
4 SASI_Mm01_00044766 predicted 633
5 SASI_Mm01_00044767 predicted 887
6 SASI_Mm01_00044769 predicted 616
7 SASI_Mm02_00318928 predicted 795
8 SASI_Mm01_00044770 predicted 1537
9 SASI_Mm01_00044771 predicted 750
10 SASI_Mm01_00044772 predicted 1332
11 SASI_Mm01_00044768 predicted 1299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002246
KCNK3 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002246.2-1713s21c1
Sequence:CCGGGTACGTTTGCATCTCTATTTACTCGAGTAAATAGAGATGCAAACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002246.2-1756s21c1
Sequence:CCGGCCACCTTCCCTTGGTTCCAAACTCGAGTTTGGAACCAAGGGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002246.2-522s21c1
Sequence:CCGGTCACGCTCGTCATGTTCCAGACTCGAGTCTGGAACATGACGAGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-854s1c1
Sequence:CCGGGCTGCGCTTCATGACCATGAACTCGAGTTCATGGTCATGAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-1064s1c1
Sequence:CCGGGTGGTACAAGAGCCGCGAGAACTCGAGTTCTCGCGGCTCTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-518s1c1
Sequence:CCGGCATCAACACCTTGGTGAGGTACTCGAGTACCTCACCAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-665s1c1
Sequence:CCGGCTACGAGCACTGGACCTTCTTCTCGAGAAGAAGGTCCAGTGCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-323s1c1
Sequence:CCGGGCTGCGCCTCAAGCCGCACAACTCGAGTTGTGCGGCTTGAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002246
KCNK3 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002246.2-1713s21c1
Sequence:CCGGGTACGTTTGCATCTCTATTTACTCGAGTAAATAGAGATGCAAACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002246.2-1756s21c1
Sequence:CCGGCCACCTTCCCTTGGTTCCAAACTCGAGTTTGGAACCAAGGGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002246.2-522s21c1
Sequence:CCGGTCACGCTCGTCATGTTCCAGACTCGAGTCTGGAACATGACGAGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-854s1c1
Sequence:CCGGGCTGCGCTTCATGACCATGAACTCGAGTTCATGGTCATGAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-1064s1c1
Sequence:CCGGGTGGTACAAGAGCCGCGAGAACTCGAGTTCTCGCGGCTCTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-518s1c1
Sequence:CCGGCATCAACACCTTGGTGAGGTACTCGAGTACCTCACCAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-665s1c1
Sequence:CCGGCTACGAGCACTGGACCTTCTTCTCGAGAAGAAGGTCCAGTGCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-323s1c1
Sequence:CCGGGCTGCGCCTCAAGCCGCACAACTCGAGTTGTGCGGCTTGAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002246
KCNK3 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433522    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002246.2-1713s21c1
Sequence:CCGGGTACGTTTGCATCTCTATTTACTCGAGTAAATAGAGATGCAAACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002246.2-1756s21c1
Sequence:CCGGCCACCTTCCCTTGGTTCCAAACTCGAGTTTGGAACCAAGGGAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002246.2-522s21c1
Sequence:CCGGTCACGCTCGTCATGTTCCAGACTCGAGTCTGGAACATGACGAGCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-854s1c1
Sequence:CCGGGCTGCGCTTCATGACCATGAACTCGAGTTCATGGTCATGAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-1064s1c1
Sequence:CCGGGTGGTACAAGAGCCGCGAGAACTCGAGTTCTCGCGGCTCTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-518s1c1
Sequence:CCGGCATCAACACCTTGGTGAGGTACTCGAGTACCTCACCAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-665s1c1
Sequence:CCGGCTACGAGCACTGGACCTTCTTCTCGAGAAGAAGGTCCAGTGCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002246.1-323s1c1
Sequence:CCGGGCTGCGCCTCAAGCCGCACAACTCGAGTTGTGCGGCTTGAGGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010608
KCNK3 MISSION shRNA Bacterial Glycerol Stock
potassium channel, subfamily K, member 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-781s1c1
Sequence:CCGGTGGACTTTCTTCCAGGCCTATCTCGAGATAGGCCTGGAAGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-1215s1c1
Sequence:CCGGCTGGTACAAGAGCCGCGAGAACTCGAGTTCTCGCGGCTCTTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-624s1c1
Sequence:CCGGCATCAACACCTTCGTGAGGTACTCGAGTACCTCACGAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-982s1c1
Sequence:CCGGGCCGAGGACGAGAAGCGTGATCTCGAGATCACGCTTCTCGTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-543s1c1
Sequence:CCGGCGGAGGCAAGGTGTTCTGCATCTCGAGATGCAGAACACCTTGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010608
KCNK3 MISSION shRNA shRNA Plasmid DNA
potassium channel, subfamily K, member 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-781s1c1
Sequence:CCGGTGGACTTTCTTCCAGGCCTATCTCGAGATAGGCCTGGAAGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-1215s1c1
Sequence:CCGGCTGGTACAAGAGCCGCGAGAACTCGAGTTCTCGCGGCTCTTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-624s1c1
Sequence:CCGGCATCAACACCTTCGTGAGGTACTCGAGTACCTCACGAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-982s1c1
Sequence:CCGGGCCGAGGACGAGAAGCGTGATCTCGAGATCACGCTTCTCGTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-543s1c1
Sequence:CCGGCGGAGGCAAGGTGTTCTGCATCTCGAGATGCAGAACACCTTGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010608
KCNK3 MISSION shRNA Lentiviral Transduction Particles
potassium channel, subfamily K, member 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-781s1c1
Sequence:CCGGTGGACTTTCTTCCAGGCCTATCTCGAGATAGGCCTGGAAGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-1215s1c1
Sequence:CCGGCTGGTACAAGAGCCGCGAGAACTCGAGTTCTCGCGGCTCTTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-624s1c1
Sequence:CCGGCATCAACACCTTCGTGAGGTACTCGAGTACCTCACGAAGGTGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-982s1c1
Sequence:CCGGGCCGAGGACGAGAAGCGTGATCTCGAGATCACGCTTCTCGTCCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010608.1-543s1c1
Sequence:CCGGCGGAGGCAAGGTGTTCTGCATCTCGAGATGCAGAACACCTTGCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks