EMAIL THIS PAGE TO A FRIEND

KCTD11

potassium channel tetramerization domain containing 11

Synonyms: C17orf36 KCASH1 REN REN/KCTD11
UniProtKB ID: Q693B1, B3KPE0
Gene ID:
Mouse(216858) potassium channel tetramerisation domain containing 11
Rat(363634) potassium channel tetramerization domain containing 11
dog(607761) potassium channel tetramerisation domain containing 11
cow(539167) potassium channel tetramerisation domain containing 11
sheep(101119573) potassium channel tetramerisation domain containing 11
domestic guinea pig(100736188) potassium channel tetramerization domain containing 11
naked mole-rat(101718156) potassium channel tetramerisation domain containing 11
121 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153143 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153143 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153143 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002914 Rosetta Predictions human pricing
NM_001108831 Rosetta Predictions rat pricing
NM_153143 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019033 predicted 1145
2 SASI_Hs02_00304263 predicted 1448
3 SASI_Hs01_00019034 predicted 1470
4 SASI_Hs01_00019035 predicted 2153
5 SASI_Hs01_00019036 predicted 1727
6 SASI_Hs01_00019037 predicted 1922
7 SASI_Hs01_00019038 predicted 1103
8 SASI_Hs01_00019039 predicted 2075
9 SASI_Hs01_00019040 predicted 1835
10 SASI_Hs01_00019041 predicted 1913
11 SASI_Hs01_00019032 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108831 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242505 predicted 854
2 SASI_Rn02_00242506 predicted 1203
3 SASI_Rn02_00242507 predicted 782
4 SASI_Rn02_00242508 predicted 855
5 SASI_Rn02_00242509 predicted 789
6 SASI_Rn02_00242510 predicted 1174
7 SASI_Rn02_00242511 predicted 1436
8 SASI_Rn02_00242512 predicted 1542
9 SASI_Rn02_00242513 predicted 1024
10 SASI_Rn02_00242514 predicted 1424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153143 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343030 predicted 1762
2 SASI_Mm01_00163045 predicted 1656
3 SASI_Mm01_00163046 predicted 1832
4 SASI_Mm01_00163047 predicted 1584
5 SASI_Mm01_00163048 predicted 1960
6 SASI_Mm01_00163049 predicted 1678
7 SASI_Mm01_00163050 predicted 1748
8 SASI_Mm01_00163051 predicted 1906
9 SASI_Mm01_00163052 predicted 1436
10 SASI_Mm01_00163053 predicted 788
11 SASI_Mm01_00163054 predicted 1223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002914
KCTD11 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-847s1c1
Sequence:CCGGCCACTACTTCATCGACCGGGACTCGAGTCCCGGTCGATGAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1441s1c1
Sequence:CCGGCCTGCTCAACTCCAGGTCTCTCTCGAGAGAGACCTGGAGTTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002914.1-2082s1c1
Sequence:CCGGGCATCCCTCATCTGGAAGAATCTCGAGATTCTTCCAGATGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1405s1c1
Sequence:CCGGCTTCCGACTAGACTCTGTCTTCTCGAGAAGACAGAGTCTAGTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1171s1c1
Sequence:CCGGCTCTGAGTGTCTAGGTGCTTTCTCGAGAAAGCACCTAGACACTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-2075s21c1
Sequence:CCGGACCCAGACTAGACCTAGCAAACTCGAGTTTGCTAGGTCTAGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-1971s21c1
Sequence:CCGGGAAGGTTCTCTCAGCTTGTTCCTCGAGGAACAAGCTGAGAGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-2225s21c1
Sequence:CCGGCACTCTGGAACATCGGAAGAGCTCGAGCTCTTCCGATGTTCCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002914.2-1320s21c1
Sequence:CCGGTGCTCCACGCAGATGTAGATGCTCGAGCATCTACATCTGCGTGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002914.2-1153s21c1
Sequence:CCGGCCGGCACATCCTCAATTTCCTCTCGAGAGGAAATTGAGGATGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002914
KCTD11 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-847s1c1
Sequence:CCGGCCACTACTTCATCGACCGGGACTCGAGTCCCGGTCGATGAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1441s1c1
Sequence:CCGGCCTGCTCAACTCCAGGTCTCTCTCGAGAGAGACCTGGAGTTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002914.1-2082s1c1
Sequence:CCGGGCATCCCTCATCTGGAAGAATCTCGAGATTCTTCCAGATGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1405s1c1
Sequence:CCGGCTTCCGACTAGACTCTGTCTTCTCGAGAAGACAGAGTCTAGTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1171s1c1
Sequence:CCGGCTCTGAGTGTCTAGGTGCTTTCTCGAGAAAGCACCTAGACACTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-2075s21c1
Sequence:CCGGACCCAGACTAGACCTAGCAAACTCGAGTTTGCTAGGTCTAGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-1971s21c1
Sequence:CCGGGAAGGTTCTCTCAGCTTGTTCCTCGAGGAACAAGCTGAGAGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-2225s21c1
Sequence:CCGGCACTCTGGAACATCGGAAGAGCTCGAGCTCTTCCGATGTTCCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002914.2-1320s21c1
Sequence:CCGGTGCTCCACGCAGATGTAGATGCTCGAGCATCTACATCTGCGTGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002914.2-1153s21c1
Sequence:CCGGCCGGCACATCCTCAATTTCCTCTCGAGAGGAAATTGAGGATGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002914
KCTD11 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-847s1c1
Sequence:CCGGCCACTACTTCATCGACCGGGACTCGAGTCCCGGTCGATGAAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1441s1c1
Sequence:CCGGCCTGCTCAACTCCAGGTCTCTCTCGAGAGAGACCTGGAGTTGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078108    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002914.1-2082s1c1
Sequence:CCGGGCATCCCTCATCTGGAAGAATCTCGAGATTCTTCCAGATGAGGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1405s1c1
Sequence:CCGGCTTCCGACTAGACTCTGTCTTCTCGAGAAGACAGAGTCTAGTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002914.1-1171s1c1
Sequence:CCGGCTCTGAGTGTCTAGGTGCTTTCTCGAGAAAGCACCTAGACACTCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-2075s21c1
Sequence:CCGGACCCAGACTAGACCTAGCAAACTCGAGTTTGCTAGGTCTAGTCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437407    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-1971s21c1
Sequence:CCGGGAAGGTTCTCTCAGCTTGTTCCTCGAGGAACAAGCTGAGAGAACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002914.2-2225s21c1
Sequence:CCGGCACTCTGGAACATCGGAAGAGCTCGAGCTCTTCCGATGTTCCAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002914.2-1320s21c1
Sequence:CCGGTGCTCCACGCAGATGTAGATGCTCGAGCATCTACATCTGCGTGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002914.2-1153s21c1
Sequence:CCGGCCGGCACATCCTCAATTTCCTCTCGAGAGGAAATTGAGGATGTGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153143
VALIDATED
KCTD11 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 11
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153143.2-1462s1c1
Sequence:CCGGCTACTCCATGCAGATGTAGATCTCGAGATCTACATCTGCATGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153143.2-1863s1c1
Sequence:CCGGGAACTCTAGATCCTTGCGCTTCTCGAGAAGCGCAAGGATCTAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153143.2-1694s1c1
Sequence:CCGGTCCCTGAAGTAGAGTATCAAACTCGAGTTTGATACTCTACTTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153143.2-1350s1c1
Sequence:CCGGCGGAGAAACTGCCCTTCTTAACTCGAGTTAAGAAGGGCAGTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153143.2-2846s1c1
Sequence:CCGGGCCCTTCCTATGAGAGGTAAACTCGAGTTTACCTCTCATAGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-1178s21c1
Sequence:CCGGGCTGCCATGCGCAACAGATTTCTCGAGAAATCTGTTGCGCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153143.4-1952s21c1
Sequence:CCGGTATGTTCCAAGCCACCTATTGCTCGAGCAATAGGTGGCTTGGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-928s21c1
Sequence:CCGGCGGAGAAACTGCCCTTCTTAACTCGAGTTAAGAAGGGCAGTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153143.4-1901s21c1
Sequence:CCGGTATCCTACAGTAACCATTAAGCTCGAGCTTAATGGTTACTGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-871s21c1
Sequence:CCGGTTTCCGGCACATCCTCAATTTCTCGAGAAATTGAGGATGTGCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-805s21c1
Sequence:CCGGCCTAATGCCAGCCAACCTTAACTCGAGTTAAGGTTGGCTGGCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153143
VALIDATED
KCTD11 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 11
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153143.2-1462s1c1
Sequence:CCGGCTACTCCATGCAGATGTAGATCTCGAGATCTACATCTGCATGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153143.2-1863s1c1
Sequence:CCGGGAACTCTAGATCCTTGCGCTTCTCGAGAAGCGCAAGGATCTAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153143.2-1694s1c1
Sequence:CCGGTCCCTGAAGTAGAGTATCAAACTCGAGTTTGATACTCTACTTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153143.2-1350s1c1
Sequence:CCGGCGGAGAAACTGCCCTTCTTAACTCGAGTTAAGAAGGGCAGTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153143.2-2846s1c1
Sequence:CCGGGCCCTTCCTATGAGAGGTAAACTCGAGTTTACCTCTCATAGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-1178s21c1
Sequence:CCGGGCTGCCATGCGCAACAGATTTCTCGAGAAATCTGTTGCGCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153143.4-1952s21c1
Sequence:CCGGTATGTTCCAAGCCACCTATTGCTCGAGCAATAGGTGGCTTGGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-928s21c1
Sequence:CCGGCGGAGAAACTGCCCTTCTTAACTCGAGTTAAGAAGGGCAGTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153143.4-1901s21c1
Sequence:CCGGTATCCTACAGTAACCATTAAGCTCGAGCTTAATGGTTACTGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-871s21c1
Sequence:CCGGTTTCCGGCACATCCTCAATTTCTCGAGAAATTGAGGATGTGCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-805s21c1
Sequence:CCGGCCTAATGCCAGCCAACCTTAACTCGAGTTAAGGTTGGCTGGCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153143
VALIDATED
KCTD11 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 11
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153143.2-1462s1c1
Sequence:CCGGCTACTCCATGCAGATGTAGATCTCGAGATCTACATCTGCATGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153143.2-1863s1c1
Sequence:CCGGGAACTCTAGATCCTTGCGCTTCTCGAGAAGCGCAAGGATCTAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153143.2-1694s1c1
Sequence:CCGGTCCCTGAAGTAGAGTATCAAACTCGAGTTTGATACTCTACTTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_153143.2-1350s1c1
Sequence:CCGGCGGAGAAACTGCCCTTCTTAACTCGAGTTAAGAAGGGCAGTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153143.2-2846s1c1
Sequence:CCGGGCCCTTCCTATGAGAGGTAAACTCGAGTTTACCTCTCATAGGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-1178s21c1
Sequence:CCGGGCTGCCATGCGCAACAGATTTCTCGAGAAATCTGTTGCGCATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153143.4-1952s21c1
Sequence:CCGGTATGTTCCAAGCCACCTATTGCTCGAGCAATAGGTGGCTTGGAACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-928s21c1
Sequence:CCGGCGGAGAAACTGCCCTTCTTAACTCGAGTTAAGAAGGGCAGTTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348261    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153143.4-1901s21c1
Sequence:CCGGTATCCTACAGTAACCATTAAGCTCGAGCTTAATGGTTACTGTAGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-871s21c1
Sequence:CCGGTTTCCGGCACATCCTCAATTTCTCGAGAAATTGAGGATGTGCCGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153143.4-805s21c1
Sequence:CCGGCCTAATGCCAGCCAACCTTAACTCGAGTTAAGGTTGGCTGGCATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks