EMAIL THIS PAGE TO A FRIEND

KCTD12

potassium channel tetramerization domain containing 12

Synonyms: C13orf2 PFET1 PFETIN
UniProtKB ID: Q96CX2
Gene ID:
Mouse(239217) potassium channel tetramerisation domain containing 12
Rat(364458) potassium channel tetramerization domain containing 12
domestic guinea pig(101787203) potassium channel tetramerization domain containing 12
naked mole-rat(101715895) potassium channel tetramerisation domain containing 12
sheep(101102499) potassium channel tetramerisation domain containing 12
chicken(425504) potassium channel tetramerisation domain containing 12
dog(485495) potassium channel tetramerisation domain containing 12
cow(616416) potassium channel tetramerization domain containing 12
domestic cat(101088711) potassium channel tetramerisation domain containing 12
242 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301428 ANTI-KCTD12 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138444 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121831 MISSION® esiRNA esiRNA human KCTD12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138444 Rosetta Predictions human pricing
XM_001076656 Rosetta Predictions rat pricing
XM_344450 Rosetta Predictions rat pricing
NM_177715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206464 predicted 1052
2 SASI_Hs01_00206465 predicted 1041
3 SASI_Hs01_00206466 predicted 1641
4 SASI_Hs01_00206467 predicted 951
5 SASI_Hs01_00206468 predicted 1539
6 SASI_Hs01_00206469 predicted 1603
7 SASI_Hs01_00206470 predicted 478
8 SASI_Hs01_00206471 predicted 1654
9 SASI_Hs01_00206472 predicted 879
10 SASI_Hs02_00363608 predicted 1619
11 SASI_Hs01_00206473 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354042 predicted 1100
2 SASI_Rn02_00354043 predicted 1010
3 SASI_Rn02_00354044 predicted 1501
4 SASI_Rn02_00354045 predicted 1616
5 SASI_Rn02_00354046 predicted 1456
6 SASI_Rn02_00354047 predicted 533
7 SASI_Rn02_00354048 predicted 1152
8 SASI_Rn02_00354049 predicted 936
9 SASI_Rn02_00354050 predicted 845
10 SASI_Rn02_00354051 predicted 1249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344450 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397101 predicted 1598
2 SASI_Rn02_00397102 predicted 1492
3 SASI_Rn02_00397103 predicted 1614
4 SASI_Rn02_00397104 predicted 1447
5 SASI_Rn02_00397105 predicted 521
6 SASI_Rn02_00397106 predicted 1501
7 SASI_Rn02_00397107 predicted 1445
8 SASI_Rn02_00397108 predicted 519
9 SASI_Rn02_00397109 predicted 1447
10 SASI_Rn02_00397110 predicted 1447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026947 predicted 1472
2 SASI_Mm01_00026948 predicted 902
3 SASI_Mm01_00026949 predicted 1498
4 SASI_Mm01_00026950 predicted 999
5 SASI_Mm02_00348061 predicted 294
6 SASI_Mm01_00026952 predicted 906
7 SASI_Mm01_00026953 predicted 1347
8 SASI_Mm01_00026954 predicted 1038
9 SASI_Mm01_00026955 predicted 420
10 SASI_Mm01_00026956 predicted 1490
11 SASI_Mm01_00026951 predicted 1267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177715
VALIDATED
KCTD12 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 12
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177715.4-2690s1c1
Sequence:CCGGCGAGCAATAACGCGGTATTTACTCGAGTAAATACCGCGTTATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1008s1c1
Sequence:CCGGCCGCTATTACCTCAAGTTCAACTCGAGTTGAACTTGAGGTAATAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1010s1c1
Sequence:CCGGGCTATTACCTCAAGTTCAACTCTCGAGAGTTGAACTTGAGGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1017s1c1
Sequence:CCGGCCTCAAGTTCAACTTCCTAGACTCGAGTCTAGGAAGTTGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177715.3-1020s1c1
Sequence:CCGGCAAGTTCAACTTCCTAGAGCACTCGAGTGCTCTAGGAAGTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-4148s1c1
Sequence:CCGGCCTGTGAATTTGATGACTGTACTCGAGTACAGTCATCAAATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177715
VALIDATED
KCTD12 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 12
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177715.4-2690s1c1
Sequence:CCGGCGAGCAATAACGCGGTATTTACTCGAGTAAATACCGCGTTATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1008s1c1
Sequence:CCGGCCGCTATTACCTCAAGTTCAACTCGAGTTGAACTTGAGGTAATAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1010s1c1
Sequence:CCGGGCTATTACCTCAAGTTCAACTCTCGAGAGTTGAACTTGAGGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1017s1c1
Sequence:CCGGCCTCAAGTTCAACTTCCTAGACTCGAGTCTAGGAAGTTGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177715.3-1020s1c1
Sequence:CCGGCAAGTTCAACTTCCTAGAGCACTCGAGTGCTCTAGGAAGTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-4148s1c1
Sequence:CCGGCCTGTGAATTTGATGACTGTACTCGAGTACAGTCATCAAATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177715
VALIDATED
KCTD12 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 12
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217763    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177715.4-2690s1c1
Sequence:CCGGCGAGCAATAACGCGGTATTTACTCGAGTAAATACCGCGTTATTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1008s1c1
Sequence:CCGGCCGCTATTACCTCAAGTTCAACTCGAGTTGAACTTGAGGTAATAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1010s1c1
Sequence:CCGGGCTATTACCTCAAGTTCAACTCTCGAGAGTTGAACTTGAGGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-1017s1c1
Sequence:CCGGCCTCAAGTTCAACTTCCTAGACTCGAGTCTAGGAAGTTGAACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177715.3-1020s1c1
Sequence:CCGGCAAGTTCAACTTCCTAGAGCACTCGAGTGCTCTAGGAAGTTGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177715.3-4148s1c1
Sequence:CCGGCCTGTGAATTTGATGACTGTACTCGAGTACAGTCATCAAATTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138444
KCTD12 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138444.2-5645s1c1
Sequence:CCGGGCGACTTTATAGGCAGGTAAACTCGAGTTTACCTGCCTATAAAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-1046s1c1
Sequence:CCGGGCGCTATTACCTCAAGTTCAACTCGAGTTGAACTTGAGGTAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-1034s1c1
Sequence:CCGGGCGCTACACCTCGCGCTATTACTCGAGTAATAGCGCGAGGTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-497s1c1
Sequence:CCGGCGGCTTCCTCTTCCGCTACATCTCGAGATGTAGCGGAAGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-506s1c1
Sequence:CCGGCTTCCGCTACATCCTGGATTACTCGAGTAATCCAGGATGTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138444
KCTD12 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138444.2-5645s1c1
Sequence:CCGGGCGACTTTATAGGCAGGTAAACTCGAGTTTACCTGCCTATAAAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-1046s1c1
Sequence:CCGGGCGCTATTACCTCAAGTTCAACTCGAGTTGAACTTGAGGTAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-1034s1c1
Sequence:CCGGGCGCTACACCTCGCGCTATTACTCGAGTAATAGCGCGAGGTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-497s1c1
Sequence:CCGGCGGCTTCCTCTTCCGCTACATCTCGAGATGTAGCGGAAGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-506s1c1
Sequence:CCGGCTTCCGCTACATCCTGGATTACTCGAGTAATCCAGGATGTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138444
KCTD12 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138444.2-5645s1c1
Sequence:CCGGGCGACTTTATAGGCAGGTAAACTCGAGTTTACCTGCCTATAAAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-1046s1c1
Sequence:CCGGGCGCTATTACCTCAAGTTCAACTCGAGTTGAACTTGAGGTAATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-1034s1c1
Sequence:CCGGGCGCTACACCTCGCGCTATTACTCGAGTAATAGCGCGAGGTGTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-497s1c1
Sequence:CCGGCGGCTTCCTCTTCCGCTACATCTCGAGATGTAGCGGAAGAGGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138444.2-506s1c1
Sequence:CCGGCTTCCGCTACATCCTGGATTACTCGAGTAATCCAGGATGTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks