EMAIL THIS PAGE TO A FRIEND

KCTD13

potassium channel tetramerization domain containing 13

Synonyms: PDIP1 POLDIP1 hBACURD1
UniProtKB ID: Q8WZ19, A8K0R5, Q96P93, Q96SA1
Gene ID:
Mouse(233877) potassium channel tetramerisation domain containing 13
Rat(293497) potassium channel tetramerization domain containing 13
sheep(101118408) potassium channel tetramerisation domain containing 13
domestic guinea pig(100732787) potassium channel tetramerization domain containing 13
naked mole-rat(101710854) potassium channel tetramerisation domain containing 13
Zebrafish(100000647) potassium channel tetramerisation domain containing 13
dog(489942) potassium channel tetramerisation domain containing 13
cow(507911) potassium channel tetramerisation domain containing 13
domestic cat(101098841) potassium channel tetramerisation domain containing 13
Gene Class: Cytoskeleton
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172747 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172747 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172747 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178863 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178863 Rosetta Predictions human pricing
NM_198736 Rosetta Predictions rat pricing
NM_172747 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120957 predicted 810
2 SASI_Hs01_00120958 predicted 1155
3 SASI_Hs01_00120959 predicted 744
4 SASI_Hs01_00120961 predicted 813
5 SASI_Hs01_00120962 predicted 461
6 SASI_Hs01_00120963 predicted 1103
7 SASI_Hs01_00120964 predicted 1381
8 SASI_Hs01_00120965 predicted 1299
9 SASI_Hs02_00369911 predicted 842
10 SASI_Hs02_00369912 predicted 1296
11 SASI_Hs01_00120956 predicted 468
12 SASI_Hs01_00120960 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117628 predicted 598
2 SASI_Rn01_00117629 predicted 1145
3 SASI_Rn01_00117630 predicted 1137
4 SASI_Rn01_00117631 predicted 1295
5 SASI_Rn01_00117632 predicted 772
6 SASI_Rn01_00117633 predicted 1096
7 SASI_Rn01_00117634 predicted 1110
8 SASI_Rn02_00269945 predicted 979
9 SASI_Rn01_00117636 predicted 747
10 SASI_Rn01_00117637 predicted 604
11 SASI_Rn01_00117635 predicted 745
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172747 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068734 predicted 1390
2 SASI_Mm02_00344586 predicted 705
3 SASI_Mm01_00068736 predicted 1420
4 SASI_Mm01_00068737 predicted 735
5 SASI_Mm01_00068738 predicted 1298
6 SASI_Mm01_00068739 predicted 1089
7 SASI_Mm01_00068740 predicted 1138
8 SASI_Mm01_00068741 predicted 684
9 SASI_Mm01_00068742 predicted 1310
10 SASI_Mm01_00068743 predicted 750
11 SASI_Mm01_00068735 predicted 455
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172747
KCTD13 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-693s1c1
Sequence:CCGGGCTTCTACACAACCGCAGTAACTCGAGTTACTGCGGTTGTGTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-885s1c1
Sequence:CCGGGTGCTGTACCTCCATAGTCTACTCGAGTAGACTATGGAGGTACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-961s1c1
Sequence:CCGGGAGACACTGAACATCTTAATTCTCGAGAATTAAGATGTTCAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-1140s1c1
Sequence:CCGGCGGCCAACAGATTGTCTTCAACTCGAGTTGAAGACAATCTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-288s1c1
Sequence:CCGGCCCGAACAGCAAGTATGTGAACTCGAGTTCACATACTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172747
KCTD13 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-693s1c1
Sequence:CCGGGCTTCTACACAACCGCAGTAACTCGAGTTACTGCGGTTGTGTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-885s1c1
Sequence:CCGGGTGCTGTACCTCCATAGTCTACTCGAGTAGACTATGGAGGTACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-961s1c1
Sequence:CCGGGAGACACTGAACATCTTAATTCTCGAGAATTAAGATGTTCAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-1140s1c1
Sequence:CCGGCGGCCAACAGATTGTCTTCAACTCGAGTTGAAGACAATCTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-288s1c1
Sequence:CCGGCCCGAACAGCAAGTATGTGAACTCGAGTTCACATACTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172747
KCTD13 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-693s1c1
Sequence:CCGGGCTTCTACACAACCGCAGTAACTCGAGTTACTGCGGTTGTGTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-885s1c1
Sequence:CCGGGTGCTGTACCTCCATAGTCTACTCGAGTAGACTATGGAGGTACAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-961s1c1
Sequence:CCGGGAGACACTGAACATCTTAATTCTCGAGAATTAAGATGTTCAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-1140s1c1
Sequence:CCGGCGGCCAACAGATTGTCTTCAACTCGAGTTGAAGACAATCTGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172747.1-288s1c1
Sequence:CCGGCCCGAACAGCAAGTATGTGAACTCGAGTTCACATACTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178863
VALIDATED
KCTD13 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 13
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-302s1c1
Sequence:CCGGCCCGAACAGCAAATACGTGAACTCGAGTTCACGTATTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-910s1c1
Sequence:CCGGCCATTGTCTATGCTACGGAGACTCGAGTCTCCGTAGCATAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-743s1c1
Sequence:CCGGCACCAGCACTTCAGATGACAACTCGAGTTGTCATCTGAAGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178863.2-467s1c1
Sequence:CCGGCTTTGGTACAATCCTCAATTACTCGAGTAATTGAGGATTGTACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-743s21c1
Sequence:CCGGCACCAGCACTTCAGATGACAACTCGAGTTGTCATCTGAAGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178863.2-716s21c1
Sequence:CCGGCAACCGCAGTAACAACAAGTACTCGAGTACTTGTTGTTACTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-302s21c1
Sequence:CCGGCCCGAACAGCAAATACGTGAACTCGAGTTCACGTATTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-910s21c1
Sequence:CCGGCCATTGTCTATGCTACGGAGACTCGAGTCTCCGTAGCATAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178863.2-1444s21c1
Sequence:CCGGAGCTGGTTAAGAGGGATTTAGCTCGAGCTAAATCCCTCTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178863
VALIDATED
KCTD13 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 13
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-302s1c1
Sequence:CCGGCCCGAACAGCAAATACGTGAACTCGAGTTCACGTATTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-910s1c1
Sequence:CCGGCCATTGTCTATGCTACGGAGACTCGAGTCTCCGTAGCATAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-743s1c1
Sequence:CCGGCACCAGCACTTCAGATGACAACTCGAGTTGTCATCTGAAGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178863.2-467s1c1
Sequence:CCGGCTTTGGTACAATCCTCAATTACTCGAGTAATTGAGGATTGTACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-743s21c1
Sequence:CCGGCACCAGCACTTCAGATGACAACTCGAGTTGTCATCTGAAGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178863.2-716s21c1
Sequence:CCGGCAACCGCAGTAACAACAAGTACTCGAGTACTTGTTGTTACTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-302s21c1
Sequence:CCGGCCCGAACAGCAAATACGTGAACTCGAGTTCACGTATTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-910s21c1
Sequence:CCGGCCATTGTCTATGCTACGGAGACTCGAGTCTCCGTAGCATAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178863.2-1444s21c1
Sequence:CCGGAGCTGGTTAAGAGGGATTTAGCTCGAGCTAAATCCCTCTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178863
VALIDATED
KCTD13 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 13
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-302s1c1
Sequence:CCGGCCCGAACAGCAAATACGTGAACTCGAGTTCACGTATTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-910s1c1
Sequence:CCGGCCATTGTCTATGCTACGGAGACTCGAGTCTCCGTAGCATAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178863.2-743s1c1
Sequence:CCGGCACCAGCACTTCAGATGACAACTCGAGTTGTCATCTGAAGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178863.2-467s1c1
Sequence:CCGGCTTTGGTACAATCCTCAATTACTCGAGTAATTGAGGATTGTACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-743s21c1
Sequence:CCGGCACCAGCACTTCAGATGACAACTCGAGTTGTCATCTGAAGTGCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178863.2-716s21c1
Sequence:CCGGCAACCGCAGTAACAACAAGTACTCGAGTACTTGTTGTTACTGCGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-302s21c1
Sequence:CCGGCCCGAACAGCAAATACGTGAACTCGAGTTCACGTATTTGCTGTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_178863.2-910s21c1
Sequence:CCGGCCATTGTCTATGCTACGGAGACTCGAGTCTCCGTAGCATAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303961    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178863.2-1444s21c1
Sequence:CCGGAGCTGGTTAAGAGGGATTTAGCTCGAGCTAAATCCCTCTTAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks