EMAIL THIS PAGE TO A FRIEND

KCTD17

potassium channel tetramerization domain containing 17

UniProtKB ID: Q8N5Z5, B0QYA9, B0QYB0, O95517
Gene ID:
Mouse(72844) potassium channel tetramerisation domain containing 17
Rat(300317) potassium channel tetramerization domain containing 17
chicken(418047) potassium channel tetramerisation domain containing 17
dog(481274) potassium channel tetramerisation domain containing 17
domestic cat(101092124) potassium channel tetramerisation domain containing 17
cow(614912) potassium channel tetramerisation domain containing 17
sheep(101106839) potassium channel tetramerisation domain containing 17
domestic guinea pig(100730087) potassium channel tetramerization domain containing 17
naked mole-rat(101697080) potassium channel tetramerisation domain containing 17
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024681 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024681 Rosetta Predictions human pricing
NM_001134529 Rosetta Predictions rat pricing
NM_001081367 Rosetta Predictions mouse pricing
XM_110121 Rosetta Predictions mouse pricing
XM_900689 Rosetta Predictions mouse pricing
XM_900696 Rosetta Predictions mouse pricing
XM_993270 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221312 predicted 354
2 SASI_Hs01_00221313 predicted 353
3 SASI_Hs01_00221314 predicted 349
4 SASI_Hs01_00221315 predicted 349
5 SASI_Hs01_00221316 predicted 319
6 SASI_Hs01_00221317 predicted 366
7 SASI_Hs01_00221318 predicted 327
8 SASI_Hs01_00221319 predicted 322
9 SASI_Hs01_00221320 predicted 462
10 SASI_Hs01_00221321 predicted 85
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256779 predicted 291
2 SASI_Rn02_00256780 predicted 327
3 SASI_Rn02_00256781 predicted 295
4 SASI_Rn02_00256782 predicted 238
5 SASI_Rn02_00256783 predicted 231
6 SASI_Rn02_00256784 predicted 394
7 SASI_Rn02_00256785 predicted 1068
8 SASI_Rn02_00256786 predicted 377
9 SASI_Rn02_00256787 predicted 1078
10 SASI_Rn02_00256788 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297721 predicted 1232
2 SASI_Mm02_00297722 predicted 868
3 SASI_Mm02_00297723 predicted 997
4 SASI_Mm02_00297724 predicted 1342
5 SASI_Mm02_00297725 predicted 791
6 SASI_Mm02_00297726 predicted 538
7 SASI_Mm02_00297727 predicted 882
8 SASI_Mm02_00297728 predicted 583
9 SASI_Mm02_00297729 predicted 1014
10 SASI_Mm02_00297730 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_110121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223502 predicted 531
2 SASI_Mm01_00223503 predicted 539
3 SASI_Mm01_00223504 predicted 586
4 SASI_Mm01_00223505 predicted 559
5 SASI_Mm01_00223506 predicted 599
6 SASI_Mm01_00223507 predicted 565
7 SASI_Mm01_00223508 predicted 533
8 SASI_Mm01_00223509 predicted 456
9 SASI_Mm01_00223510 predicted 641
10 SASI_Mm01_00223511 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00274918 predicted 530
2 SASI_Mm01_00274919 predicted 1246
3 SASI_Mm01_00274920 predicted 880
4 SASI_Mm01_00274921 predicted 1000
5 SASI_Mm01_00274922 predicted 1349
6 SASI_Mm01_00274923 predicted 545
7 SASI_Mm01_00274924 predicted 885
8 SASI_Mm01_00274925 predicted 584
9 SASI_Mm01_00274926 predicted 1013
10 SASI_Mm01_00274927 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204073 predicted 525
2 SASI_Mm01_00204074 predicted 540
3 SASI_Mm01_00204075 predicted 587
4 SASI_Mm01_00204076 predicted 557
5 SASI_Mm01_00204077 predicted 765
6 SASI_Mm01_00204078 predicted 571
7 SASI_Mm01_00204079 predicted 642
8 SASI_Mm01_00204080 predicted 374
9 SASI_Mm01_00204081 predicted 774
10 SASI_Mm01_00204082 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259202 predicted 525
2 SASI_Mm01_00259203 predicted 544
3 SASI_Mm01_00259204 predicted 584
4 SASI_Mm01_00259205 predicted 559
5 SASI_Mm01_00259206 predicted 595
6 SASI_Mm01_00259207 predicted 571
7 SASI_Mm01_00259208 predicted 524
8 SASI_Mm01_00259209 predicted 448
9 SASI_Mm01_00259210 predicted 644
10 SASI_Mm01_00259211 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024681
KCTD17 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1519s1c1
Sequence:CCGGCCTGGGCATAACACTGTGTTTCTCGAGAAACACAGTGTTATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-630s1c1
Sequence:CCGGCAAATGGTCTCCACCATGTCTCTCGAGAGACATGGTGGAGACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-521s1c1
Sequence:CCGGGCTGATCCGCATCATCAAAGACTCGAGTCTTTGATGATGCGGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-530s1c1
Sequence:CCGGCATCATCAAAGACCGGATGGACTCGAGTCCATCCGGTCTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-880s1c1
Sequence:CCGGCAGATGCACAGGAGAAAGGTTCTCGAGAACCTTTCTCCTGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1540s1c1
Sequence:CCGGGCAAATGGAGATTCAGGTATTCTCGAGAATACCTGAATCTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1525s1c1
Sequence:CCGGCATAACACTGTGTTTGCAAATCTCGAGATTTGCAAACACAGTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024681.2-1189s21c1
Sequence:CCGGCATTGCCTCCTTGAGCCTTAGCTCGAGCTAAGGCTCAAGGAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024681.2-767s21c1
Sequence:CCGGGAGCTTGCAGTGAGGGCTTCTCTCGAGAGAAGCCCTCACTGCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024681
KCTD17 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1519s1c1
Sequence:CCGGCCTGGGCATAACACTGTGTTTCTCGAGAAACACAGTGTTATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-630s1c1
Sequence:CCGGCAAATGGTCTCCACCATGTCTCTCGAGAGACATGGTGGAGACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-521s1c1
Sequence:CCGGGCTGATCCGCATCATCAAAGACTCGAGTCTTTGATGATGCGGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-530s1c1
Sequence:CCGGCATCATCAAAGACCGGATGGACTCGAGTCCATCCGGTCTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-880s1c1
Sequence:CCGGCAGATGCACAGGAGAAAGGTTCTCGAGAACCTTTCTCCTGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1540s1c1
Sequence:CCGGGCAAATGGAGATTCAGGTATTCTCGAGAATACCTGAATCTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1525s1c1
Sequence:CCGGCATAACACTGTGTTTGCAAATCTCGAGATTTGCAAACACAGTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024681.2-1189s21c1
Sequence:CCGGCATTGCCTCCTTGAGCCTTAGCTCGAGCTAAGGCTCAAGGAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024681.2-767s21c1
Sequence:CCGGGAGCTTGCAGTGAGGGCTTCTCTCGAGAGAAGCCCTCACTGCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024681
KCTD17 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166543    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1519s1c1
Sequence:CCGGCCTGGGCATAACACTGTGTTTCTCGAGAAACACAGTGTTATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-630s1c1
Sequence:CCGGCAAATGGTCTCCACCATGTCTCTCGAGAGACATGGTGGAGACCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165606    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-521s1c1
Sequence:CCGGGCTGATCCGCATCATCAAAGACTCGAGTCTTTGATGATGCGGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-530s1c1
Sequence:CCGGCATCATCAAAGACCGGATGGACTCGAGTCCATCCGGTCTTTGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024681.1-880s1c1
Sequence:CCGGCAGATGCACAGGAGAAAGGTTCTCGAGAACCTTTCTCCTGTGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159132    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1540s1c1
Sequence:CCGGGCAAATGGAGATTCAGGTATTCTCGAGAATACCTGAATCTCCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024681.1-1525s1c1
Sequence:CCGGCATAACACTGTGTTTGCAAATCTCGAGATTTGCAAACACAGTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445876    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024681.2-1189s21c1
Sequence:CCGGCATTGCCTCCTTGAGCCTTAGCTCGAGCTAAGGCTCAAGGAGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024681.2-767s21c1
Sequence:CCGGGAGCTTGCAGTGAGGGCTTCTCTCGAGAGAAGCCCTCACTGCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081367
VALIDATED
KCTD17 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081367.1-817s21c1
Sequence:CCGGTTCCGATCTGAAATCCTTTATCTCGAGATAAAGGATTTCAGATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-1023s21c1
Sequence:CCGGGTGGCACTACCTACCCATATCCTCGAGGATATGGGTAGGTAGTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-213s21c1
Sequence:CCGGTCAGGGCGAAGAGCTTCAATCCTCGAGGATTGAAGCTCTTCGCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-441s21c1
Sequence:CCGGGGTGCCACCTAAGCATGTATACTCGAGTATACATGCTTAGGTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-386s21c1
Sequence:CCGGCTCTGATTCGAATCATCAAAGCTCGAGCTTTGATGATTCGAATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081367
VALIDATED
KCTD17 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081367.1-817s21c1
Sequence:CCGGTTCCGATCTGAAATCCTTTATCTCGAGATAAAGGATTTCAGATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-1023s21c1
Sequence:CCGGGTGGCACTACCTACCCATATCCTCGAGGATATGGGTAGGTAGTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-213s21c1
Sequence:CCGGTCAGGGCGAAGAGCTTCAATCCTCGAGGATTGAAGCTCTTCGCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-441s21c1
Sequence:CCGGGGTGCCACCTAAGCATGTATACTCGAGTATACATGCTTAGGTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-386s21c1
Sequence:CCGGCTCTGATTCGAATCATCAAAGCTCGAGCTTTGATGATTCGAATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081367
VALIDATED
KCTD17 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081367.1-817s21c1
Sequence:CCGGTTCCGATCTGAAATCCTTTATCTCGAGATAAAGGATTTCAGATCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-1023s21c1
Sequence:CCGGGTGGCACTACCTACCCATATCCTCGAGGATATGGGTAGGTAGTGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-213s21c1
Sequence:CCGGTCAGGGCGAAGAGCTTCAATCCTCGAGGATTGAAGCTCTTCGCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-441s21c1
Sequence:CCGGGGTGCCACCTAAGCATGTATACTCGAGTATACATGCTTAGGTGGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081367.1-386s21c1
Sequence:CCGGCTCTGATTCGAATCATCAAAGCTCGAGCTTTGATGATTCGAATCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks