EMAIL THIS PAGE TO A FRIEND

KCTD18

potassium channel tetramerization domain containing 18

Synonyms: 6530404F10Rik
UniProtKB ID: Q6PI47, Q53T21, Q6NW26, Q6PCD8, Q8N9B7, Q96N73
Gene ID:
Mouse(51960) potassium channel tetramerisation domain containing 18
Rat(301436) potassium channel tetramerization domain containing 18
domestic guinea pig(100720762) potassium channel tetramerization domain containing 18
naked mole-rat(101724557) potassium channel tetramerisation domain containing 18
sheep(101104044) potassium channel tetramerisation domain containing 18
chicken(424069) potassium channel tetramerisation domain containing 18
domestic cat(101084725) potassium channel tetramerisation domain containing 18
cow(613694) potassium channel tetramerisation domain containing 18
dog(488464) potassium channel tetramerisation domain containing 18
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030211 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030211 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030211 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152387 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152387 Rosetta Predictions human pricing
NM_001106914 Rosetta Predictions rat pricing
NM_030211 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206154 predicted 846
2 SASI_Hs01_00206155 predicted 1792
3 SASI_Hs02_00366055 predicted 894
4 SASI_Hs02_00366056 predicted 716
5 SASI_Hs01_00206156 predicted 981
6 SASI_Hs01_00206157 predicted 1891
7 SASI_Hs01_00206158 predicted 1109
8 SASI_Hs01_00206159 predicted 1595
9 SASI_Hs01_00206160 predicted 814
10 SASI_Hs01_00206161 predicted 879
11 SASI_Hs01_00206162 predicted 1810
12 SASI_Hs01_00206163 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223646 predicted 3753
2 SASI_Rn02_00223647 predicted 3871
3 SASI_Rn02_00223648 predicted 3754
4 SASI_Rn02_00223649 predicted 3598
5 SASI_Rn02_00223650 predicted 3962
6 SASI_Rn02_00223651 predicted 3942
7 SASI_Rn02_00223652 predicted 3922
8 SASI_Rn02_00223653 predicted 4910
9 SASI_Rn02_00223654 predicted 4815
10 SASI_Rn02_00223655 predicted 3941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030211 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078223 predicted 417
2 SASI_Mm02_00336641 predicted 1042
3 SASI_Mm01_00078225 predicted 285
4 SASI_Mm01_00078226 predicted 194
5 SASI_Mm01_00078227 predicted 1186
6 SASI_Mm01_00078228 predicted 484
7 SASI_Mm01_00078229 predicted 461
8 SASI_Mm01_00078230 predicted 445
9 SASI_Mm01_00078231 predicted 1184
10 SASI_Mm01_00078232 predicted 470
11 SASI_Mm01_00078224 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030211
KCTD18 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 18
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030211.2-130s1c1
Sequence:CCGGCTAGATATCCTTCGGCTGAATCTCGAGATTCAGCCGAAGGATATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-1455s1c1
Sequence:CCGGCCACAAACATACACACAGAATCTCGAGATTCTGTGTGTATGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030211.1-193s1c1
Sequence:CCGGCCGCTTTAAGGATTCTATGCTCTCGAGAGCATAGAATCCTTAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-1454s1c1
Sequence:CCGGCCCACAAACATACACACAGAACTCGAGTTCTGTGTGTATGTTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030211.1-422s1c1
Sequence:CCGGGCCAATGAGATGGAGACATATCTCGAGATATGTCTCCATCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030211.1-279s1c1
Sequence:CCGGGTGATGGACATCTATTCAAATCTCGAGATTTGAATAGATGTCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-2098s1c1
Sequence:CCGGCCAGTTTACTAAGGTAGTCATCTCGAGATGACTACCTTAGTAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030211
KCTD18 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 18
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030211.2-130s1c1
Sequence:CCGGCTAGATATCCTTCGGCTGAATCTCGAGATTCAGCCGAAGGATATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-1455s1c1
Sequence:CCGGCCACAAACATACACACAGAATCTCGAGATTCTGTGTGTATGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030211.1-193s1c1
Sequence:CCGGCCGCTTTAAGGATTCTATGCTCTCGAGAGCATAGAATCCTTAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-1454s1c1
Sequence:CCGGCCCACAAACATACACACAGAACTCGAGTTCTGTGTGTATGTTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030211.1-422s1c1
Sequence:CCGGGCCAATGAGATGGAGACATATCTCGAGATATGTCTCCATCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030211.1-279s1c1
Sequence:CCGGGTGATGGACATCTATTCAAATCTCGAGATTTGAATAGATGTCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-2098s1c1
Sequence:CCGGCCAGTTTACTAAGGTAGTCATCTCGAGATGACTACCTTAGTAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030211
KCTD18 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 18
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030211.2-130s1c1
Sequence:CCGGCTAGATATCCTTCGGCTGAATCTCGAGATTCAGCCGAAGGATATCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-1455s1c1
Sequence:CCGGCCACAAACATACACACAGAATCTCGAGATTCTGTGTGTATGTTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030211.1-193s1c1
Sequence:CCGGCCGCTTTAAGGATTCTATGCTCTCGAGAGCATAGAATCCTTAAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198680    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-1454s1c1
Sequence:CCGGCCCACAAACATACACACAGAACTCGAGTTCTGTGTGTATGTTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030211.1-422s1c1
Sequence:CCGGGCCAATGAGATGGAGACATATCTCGAGATATGTCTCCATCTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030211.1-279s1c1
Sequence:CCGGGTGATGGACATCTATTCAAATCTCGAGATTTGAATAGATGTCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030211.1-2098s1c1
Sequence:CCGGCCAGTTTACTAAGGTAGTCATCTCGAGATGACTACCTTAGTAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152387
KCTD18 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-680s1c1
Sequence:CCGGGCTTGTGTTATTGACCGTGATCTCGAGATCACGGTCAATAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152387.2-2352s1c1
Sequence:CCGGGCACTTTGACTCTCACTTAATCTCGAGATTAAGTGAGAGTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1357s1c1
Sequence:CCGGCCCTTCCACAAGTACCCAAATCTCGAGATTTGGGTACTTGTGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1358s1c1
Sequence:CCGGCCTTCCACAAGTACCCAAATTCTCGAGAATTTGGGTACTTGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152387.2-2217s1c1
Sequence:CCGGCCTGTACTATATCACAGCCAACTCGAGTTGGCTGTGATATAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-1305s1c1
Sequence:CCGGCGGACGAAAGTGTGAACTATACTCGAGTATAGTTCACACTTTCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-839s1c1
Sequence:CCGGGCCAATGAAATGGAGACATATCTCGAGATATGTCTCCATTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152387.2-2600s1c1
Sequence:CCGGCCACTGAAGATTCATTCTGATCTCGAGATCAGAATGAATCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1100s1c1
Sequence:CCGGGTTCAGTACATTTGGAGCTATCTCGAGATAGCTCCAAATGTACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152387
KCTD18 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-680s1c1
Sequence:CCGGGCTTGTGTTATTGACCGTGATCTCGAGATCACGGTCAATAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152387.2-2352s1c1
Sequence:CCGGGCACTTTGACTCTCACTTAATCTCGAGATTAAGTGAGAGTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1357s1c1
Sequence:CCGGCCCTTCCACAAGTACCCAAATCTCGAGATTTGGGTACTTGTGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1358s1c1
Sequence:CCGGCCTTCCACAAGTACCCAAATTCTCGAGAATTTGGGTACTTGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152387.2-2217s1c1
Sequence:CCGGCCTGTACTATATCACAGCCAACTCGAGTTGGCTGTGATATAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-1305s1c1
Sequence:CCGGCGGACGAAAGTGTGAACTATACTCGAGTATAGTTCACACTTTCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-839s1c1
Sequence:CCGGGCCAATGAAATGGAGACATATCTCGAGATATGTCTCCATTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152387.2-2600s1c1
Sequence:CCGGCCACTGAAGATTCATTCTGATCTCGAGATCAGAATGAATCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1100s1c1
Sequence:CCGGGTTCAGTACATTTGGAGCTATCTCGAGATAGCTCCAAATGTACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152387
KCTD18 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-680s1c1
Sequence:CCGGGCTTGTGTTATTGACCGTGATCTCGAGATCACGGTCAATAACACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152387.2-2352s1c1
Sequence:CCGGGCACTTTGACTCTCACTTAATCTCGAGATTAAGTGAGAGTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1357s1c1
Sequence:CCGGCCCTTCCACAAGTACCCAAATCTCGAGATTTGGGTACTTGTGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1358s1c1
Sequence:CCGGCCTTCCACAAGTACCCAAATTCTCGAGAATTTGGGTACTTGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152387.2-2217s1c1
Sequence:CCGGCCTGTACTATATCACAGCCAACTCGAGTTGGCTGTGATATAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-1305s1c1
Sequence:CCGGCGGACGAAAGTGTGAACTATACTCGAGTATAGTTCACACTTTCGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152387.2-839s1c1
Sequence:CCGGGCCAATGAAATGGAGACATATCTCGAGATATGTCTCCATTTCATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147144    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152387.2-2600s1c1
Sequence:CCGGCCACTGAAGATTCATTCTGATCTCGAGATCAGAATGAATCTTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152387.2-1100s1c1
Sequence:CCGGGTTCAGTACATTTGGAGCTATCTCGAGATAGCTCCAAATGTACTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks