EMAIL THIS PAGE TO A FRIEND

KCTD7

potassium channel tetramerization domain containing 7

Synonyms: CLN14 EPM3
UniProtKB ID: Q96MP8, A4D2M4, Q8IVR0
Gene ID:
Human(154881) Summary: This gene encodes a member of the potassium channel tetramerization domain-containing protein family. Family members are identified on a structural basis and contain an amino-terminal domain similar to the T1 domain present in the voltage-gated potassium channel. Mutations in this gene have been associated with progressive myoclonic epilepsy-3. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2011]
Mouse(212919) potassium channel tetramerisation domain containing 7
Rat(688993) potassium channel tetramerization domain containing 7
Zebrafish(735248) potassium channel tetramerisation domain containing 7
cow(100124502) potassium channel tetramerisation domain containing 7
dog(606996) potassium channel tetramerisation domain containing 7
chicken(417547) potassium channel tetramerisation domain containing 7
sheep(101110559) potassium channel tetramerisation domain containing 7
domestic guinea pig(101788016) potassium channel tetramerization domain containing 7
naked mole-rat(101712678) potassium channel tetramerisation domain containing 7
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408394 Anti-KCTD7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2101237 Anti-KCTD7 antibody produced in rabbit affinity isolated antibody human, rabbit, canine, mouse, bovine, rat, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153033 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153033 Rosetta Predictions human pricing
NM_001128194 Rosetta Predictions rat pricing
XM_001069104 Rosetta Predictions rat pricing
NM_172509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228144 predicted 1331
2 SASI_Hs01_00228145 predicted 412
3 SASI_Hs01_00228146 predicted 1388
4 SASI_Hs01_00228147 predicted 380
5 SASI_Hs01_00228148 predicted 734
6 SASI_Hs01_00228149 predicted 570
7 SASI_Hs01_00228150 predicted 1218
8 SASI_Hs01_00228151 predicted 1338
9 SASI_Hs02_00366988 predicted 1209
10 SASI_Hs01_00228152 predicted 902
11 SASI_Hs01_00228153 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255120 predicted 1007
2 SASI_Rn02_00255121 predicted 758
3 SASI_Rn02_00255122 predicted 773
4 SASI_Rn02_00255123 predicted 707
5 SASI_Rn02_00255124 predicted 787
6 SASI_Rn02_00255125 predicted 812
7 SASI_Rn02_00255126 predicted 1067
8 SASI_Rn02_00255127 predicted 799
9 SASI_Rn02_00255128 predicted 939
10 SASI_Rn02_00255129 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069104 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326922 predicted 285
2 SASI_Rn02_00326923 predicted 284
3 SASI_Rn02_00326924 predicted 291
4 SASI_Rn02_00326925 predicted 251
5 SASI_Rn02_00326926 predicted 208
6 SASI_Rn02_00326927 predicted 294
7 SASI_Rn02_00326928 predicted 286
8 SASI_Rn02_00326929 predicted 205
9 SASI_Rn02_00326930 predicted 260
10 SASI_Rn02_00326931 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196379 predicted 1418
2 SASI_Mm01_00196380 predicted 869
3 SASI_Mm01_00196381 predicted 836
4 SASI_Mm01_00196382 predicted 472
5 SASI_Mm01_00196383 predicted 508
6 SASI_Mm01_00196384 predicted 372
7 SASI_Mm01_00196385 predicted 666
8 SASI_Mm01_00196386 predicted 847
9 SASI_Mm01_00196387 predicted 1552
10 SASI_Mm01_00196388 predicted 368
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153033
KCTD7 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-587s1c1
Sequence:CCGGGCCCTATTACAAAGACCACTTCTCGAGAAGTGGTCTTTGTAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-387s1c1
Sequence:CCGGCGGTACTTCATCGACCGAGATCTCGAGATCTCGGTCGATGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-243s1c1
Sequence:CCGGCCACAGGAGTTTCCTGAGGTTCTCGAGAACCTCAGGAAACTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-665s1c1
Sequence:CCGGCAAGCTCAAGGTCTGTGTCTTCTCGAGAAGACACAGACCTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-920s1c1
Sequence:CCGGCGTGAACCACTACTACTGCAACTCGAGTTGCAGTAGTAGTGGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153033.3-561s21c1
Sequence:CCGGACAAAGAGGCCCAGTACTATGCTCGAGCATAGTACTGGGCCTCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153033.3-1462s21c1
Sequence:CCGGTCCCTTGTGCTCAGTATATTGCTCGAGCAATATACTGAGCACAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153033
KCTD7 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-587s1c1
Sequence:CCGGGCCCTATTACAAAGACCACTTCTCGAGAAGTGGTCTTTGTAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-387s1c1
Sequence:CCGGCGGTACTTCATCGACCGAGATCTCGAGATCTCGGTCGATGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-243s1c1
Sequence:CCGGCCACAGGAGTTTCCTGAGGTTCTCGAGAACCTCAGGAAACTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-665s1c1
Sequence:CCGGCAAGCTCAAGGTCTGTGTCTTCTCGAGAAGACACAGACCTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-920s1c1
Sequence:CCGGCGTGAACCACTACTACTGCAACTCGAGTTGCAGTAGTAGTGGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153033.3-561s21c1
Sequence:CCGGACAAAGAGGCCCAGTACTATGCTCGAGCATAGTACTGGGCCTCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153033.3-1462s21c1
Sequence:CCGGTCCCTTGTGCTCAGTATATTGCTCGAGCAATATACTGAGCACAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153033
KCTD7 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-587s1c1
Sequence:CCGGGCCCTATTACAAAGACCACTTCTCGAGAAGTGGTCTTTGTAATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-387s1c1
Sequence:CCGGCGGTACTTCATCGACCGAGATCTCGAGATCTCGGTCGATGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-243s1c1
Sequence:CCGGCCACAGGAGTTTCCTGAGGTTCTCGAGAACCTCAGGAAACTCCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-665s1c1
Sequence:CCGGCAAGCTCAAGGTCTGTGTCTTCTCGAGAAGACACAGACCTTGAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153033.1-920s1c1
Sequence:CCGGCGTGAACCACTACTACTGCAACTCGAGTTGCAGTAGTAGTGGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153033.3-561s21c1
Sequence:CCGGACAAAGAGGCCCAGTACTATGCTCGAGCATAGTACTGGGCCTCTTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414045    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153033.3-1462s21c1
Sequence:CCGGTCCCTTGTGCTCAGTATATTGCTCGAGCAATATACTGAGCACAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172509
VALIDATED
KCTD7 MISSION shRNA Bacterial Glycerol Stock
potassium channel tetramerization domain containing 7
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-476s1c1
Sequence:CCGGCGGTACTTCATCGATCGAGATCTCGAGATCTCGATCGATGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-1003s1c1
Sequence:CCGGGCACCTTGTCAACCATTACTACTCGAGTAGTAATGGTTGACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-1010s1c1
Sequence:CCGGGTCAACCATTACTACTGCAAACTCGAGTTTGCAGTAGTAATGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-743s1c1
Sequence:CCGGGCCCGCTTTGCCAAGCTCAAACTCGAGTTTGAGCTTGGCAAAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172509.1-811s1c1
Sequence:CCGGGCTCCTCAACTCCCTTCGCTTCTCGAGAAGCGAAGGGAGTTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172509.3-909s21c1
Sequence:CCGGGGCTGATGTATACGACCTCTTCTCGAGAAGAGGTCGTATACATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172509
VALIDATED
KCTD7 MISSION shRNA shRNA Plasmid DNA
potassium channel tetramerization domain containing 7
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-476s1c1
Sequence:CCGGCGGTACTTCATCGATCGAGATCTCGAGATCTCGATCGATGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-1003s1c1
Sequence:CCGGGCACCTTGTCAACCATTACTACTCGAGTAGTAATGGTTGACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-1010s1c1
Sequence:CCGGGTCAACCATTACTACTGCAAACTCGAGTTTGCAGTAGTAATGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-743s1c1
Sequence:CCGGGCCCGCTTTGCCAAGCTCAAACTCGAGTTTGAGCTTGGCAAAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172509.1-811s1c1
Sequence:CCGGGCTCCTCAACTCCCTTCGCTTCTCGAGAAGCGAAGGGAGTTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172509.3-909s21c1
Sequence:CCGGGGCTGATGTATACGACCTCTTCTCGAGAAGAGGTCGTATACATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172509
VALIDATED
KCTD7 MISSION shRNA Lentiviral Transduction Particles
potassium channel tetramerization domain containing 7
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-476s1c1
Sequence:CCGGCGGTACTTCATCGATCGAGATCTCGAGATCTCGATCGATGAAGTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-1003s1c1
Sequence:CCGGGCACCTTGTCAACCATTACTACTCGAGTAGTAATGGTTGACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-1010s1c1
Sequence:CCGGGTCAACCATTACTACTGCAAACTCGAGTTTGCAGTAGTAATGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172509.1-743s1c1
Sequence:CCGGGCCCGCTTTGCCAAGCTCAAACTCGAGTTTGAGCTTGGCAAAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172509.1-811s1c1
Sequence:CCGGGCTCCTCAACTCCCTTCGCTTCTCGAGAAGCGAAGGGAGTTGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172509.3-909s21c1
Sequence:CCGGGGCTGATGTATACGACCTCTTCTCGAGAAGAGGTCGTATACATCAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks