EMAIL THIS PAGE TO A FRIEND

KDELR1

KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1

Synonyms: ERD2 ERD2.1 HDEL PM23
UniProtKB ID: P24390, B2R6N4, Q54A39
Gene ID:
Human(10945) Summary: Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, which is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. The protein encoded by this gene was the first member of the family to be identified, and it encodes a protein structurally and functionally similar to the yeast ERD2 gene product. [provided by RefSeq, Jul 2008]
Mouse(68137) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Rat(361577) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
dog(484406) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
cow(618184) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
domestic cat(101088968) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
domestic guinea pig(100733302) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
naked mole-rat(101696486) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047440 Anti-KDELR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1305245 ANTI-KDELR1(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB5200004 Monoclonal Anti-KDELR1 antibody produced in mouse clone KR10, 1 mg/mL, purified immunoglobulin Drosophila, rabbit, monkey, human, bovine, sheep, Xenopus, canine, rat, hamster, pig, mouse, chicken
immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006801 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006801 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006801 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006801 Rosetta Predictions human pricing
NM_001017385 Rosetta Predictions rat pricing
NM_133950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006801 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053547 predicted 654
2 SASI_Hs01_00053549 predicted 804
3 SASI_Hs01_00053550 predicted 645
4 SASI_Hs01_00053551 predicted 671
5 SASI_Hs01_00053552 predicted 374
6 SASI_Hs02_00342320 predicted 773
7 SASI_Hs01_00053553 predicted 371
8 SASI_Hs01_00053554 predicted 753
9 SASI_Hs01_00053555 predicted 318
10 SASI_Hs01_00053556 predicted 327
11 SASI_Hs01_00053548 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037558 predicted 548
2 SASI_Rn01_00037559 predicted 278
3 SASI_Rn01_00037561 predicted 325
4 SASI_Rn01_00037562 predicted 269
5 SASI_Rn01_00037563 predicted 340
6 SASI_Rn01_00037564 predicted 245
7 SASI_Rn01_00037565 predicted 560
8 SASI_Rn01_00037566 predicted 525
9 SASI_Rn01_00037567 predicted 1191
10 SASI_Rn02_00202230 predicted 467
11 SASI_Rn01_00037560 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049294 predicted 676
2 SASI_Mm01_00049292 predicted 641
3 SASI_Mm02_00339058 predicted 457
4 SASI_Mm01_00049295 predicted 548
5 SASI_Mm01_00049296 predicted 614
6 SASI_Mm01_00049297 predicted 595
7 SASI_Mm01_00049298 predicted 645
8 SASI_Mm01_00049299 predicted 419
9 SASI_Mm02_00339059 predicted 670
10 SASI_Mm01_00049300 predicted 346
11 SASI_Mm01_00049293 predicted 365
12 SASI_Mm01_00049301 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006801
VALIDATED
KDELR1 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-354s1c1
Sequence:CCGGCAACTACATCTCACTCTACAACTCGAGTTGTAGAGTGAGATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-675s1c1
Sequence:CCGGGCTCTATCTCTTCAACTGGATCTCGAGATCCAGTTGAAGAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006801.2-640s1c1
Sequence:CCGGAGCCACTACTTGTTTGCGCTACTCGAGTAGCGCAAACAAGTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-445s1c1
Sequence:CCGGGCTACTTACGATGGGAACCATCTCGAGATGGTTCCCATCGTAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-770s1c1
Sequence:CCGGGCGATTTCTTCTACCTCTATACTCGAGTATAGAGGTAGAAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-320s21c1
Sequence:CCGGTGGTGTTCACTGCCCGATATCCTCGAGGATATCGGGCAGTGAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-675s21c1
Sequence:CCGGGCTCTATCTCTTCAACTGGATCTCGAGATCCAGTTGAAGAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-354s21c1
Sequence:CCGGCAACTACATCTCACTCTACAACTCGAGTTGTAGAGTGAGATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-770s21c1
Sequence:CCGGGCGATTTCTTCTACCTCTATACTCGAGTATAGAGGTAGAAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-1225s21c1
Sequence:CCGGACTGGTTGCCAAACACTAAATCTCGAGATTTAGTGTTTGGCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006801
VALIDATED
KDELR1 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-354s1c1
Sequence:CCGGCAACTACATCTCACTCTACAACTCGAGTTGTAGAGTGAGATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-675s1c1
Sequence:CCGGGCTCTATCTCTTCAACTGGATCTCGAGATCCAGTTGAAGAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006801.2-640s1c1
Sequence:CCGGAGCCACTACTTGTTTGCGCTACTCGAGTAGCGCAAACAAGTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-445s1c1
Sequence:CCGGGCTACTTACGATGGGAACCATCTCGAGATGGTTCCCATCGTAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-770s1c1
Sequence:CCGGGCGATTTCTTCTACCTCTATACTCGAGTATAGAGGTAGAAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-320s21c1
Sequence:CCGGTGGTGTTCACTGCCCGATATCCTCGAGGATATCGGGCAGTGAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-675s21c1
Sequence:CCGGGCTCTATCTCTTCAACTGGATCTCGAGATCCAGTTGAAGAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-354s21c1
Sequence:CCGGCAACTACATCTCACTCTACAACTCGAGTTGTAGAGTGAGATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-770s21c1
Sequence:CCGGGCGATTTCTTCTACCTCTATACTCGAGTATAGAGGTAGAAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-1225s21c1
Sequence:CCGGACTGGTTGCCAAACACTAAATCTCGAGATTTAGTGTTTGGCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006801
VALIDATED
KDELR1 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-354s1c1
Sequence:CCGGCAACTACATCTCACTCTACAACTCGAGTTGTAGAGTGAGATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-675s1c1
Sequence:CCGGGCTCTATCTCTTCAACTGGATCTCGAGATCCAGTTGAAGAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006801.2-640s1c1
Sequence:CCGGAGCCACTACTTGTTTGCGCTACTCGAGTAGCGCAAACAAGTAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-445s1c1
Sequence:CCGGGCTACTTACGATGGGAACCATCTCGAGATGGTTCCCATCGTAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006801.2-770s1c1
Sequence:CCGGGCGATTTCTTCTACCTCTATACTCGAGTATAGAGGTAGAAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-320s21c1
Sequence:CCGGTGGTGTTCACTGCCCGATATCCTCGAGGATATCGGGCAGTGAACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-675s21c1
Sequence:CCGGGCTCTATCTCTTCAACTGGATCTCGAGATCCAGTTGAAGAGATAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-354s21c1
Sequence:CCGGCAACTACATCTCACTCTACAACTCGAGTTGTAGAGTGAGATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-770s21c1
Sequence:CCGGGCGATTTCTTCTACCTCTATACTCGAGTATAGAGGTAGAAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006801.2-1225s21c1
Sequence:CCGGACTGGTTGCCAAACACTAAATCTCGAGATTTAGTGTTTGGCAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133950
VALIDATED
KDELR1 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133950.1-744s1c1
Sequence:CCGGCTGCGATTTCTTCTACCTCTACTCGAGTAGAGGTAGAAGAAATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133950.1-207s1c1
Sequence:CCGGCCTCCTAGCTATCATCTTGTTCTCGAGAACAAGATGATAGCTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-330s1c1
Sequence:CCGGCAACTACATTTCACTCTACAACTCGAGTTGTAGAGTGAAATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-647s1c1
Sequence:CCGGGTACACTCTATCTCTTCAATTCTCGAGAATTGAAGAGATAGAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-451s1c1
Sequence:CCGGCGGGTGGAGTTCCTCGTTGTTCTCGAGAACAACGAGGAACTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133950
VALIDATED
KDELR1 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133950.1-744s1c1
Sequence:CCGGCTGCGATTTCTTCTACCTCTACTCGAGTAGAGGTAGAAGAAATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133950.1-207s1c1
Sequence:CCGGCCTCCTAGCTATCATCTTGTTCTCGAGAACAAGATGATAGCTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-330s1c1
Sequence:CCGGCAACTACATTTCACTCTACAACTCGAGTTGTAGAGTGAAATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-647s1c1
Sequence:CCGGGTACACTCTATCTCTTCAATTCTCGAGAATTGAAGAGATAGAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-451s1c1
Sequence:CCGGCGGGTGGAGTTCCTCGTTGTTCTCGAGAACAACGAGGAACTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133950
VALIDATED
KDELR1 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133950.1-744s1c1
Sequence:CCGGCTGCGATTTCTTCTACCTCTACTCGAGTAGAGGTAGAAGAAATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133950.1-207s1c1
Sequence:CCGGCCTCCTAGCTATCATCTTGTTCTCGAGAACAAGATGATAGCTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-330s1c1
Sequence:CCGGCAACTACATTTCACTCTACAACTCGAGTTGTAGAGTGAAATGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-647s1c1
Sequence:CCGGGTACACTCTATCTCTTCAATTCTCGAGAATTGAAGAGATAGAGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133950.1-451s1c1
Sequence:CCGGCGGGTGGAGTTCCTCGTTGTTCTCGAGAACAACGAGGAACTCCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks