EMAIL THIS PAGE TO A FRIEND

KDELR2

KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2

Synonyms: ELP-1 ERD2.2
UniProtKB ID: P33947, A4D2P4, Q6IPC5, Q96E30
Gene ID:
Human(11014) Summary: Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR2 was the second member of the family to be identified, and it encodes a protein which is 83% identical to the KDELR1 gene product. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(66913) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Rat(304290) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Goat(100861344) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
sheep(101116624) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
domestic guinea pig(100727948) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
naked mole-rat(101701913) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
chicken(771927) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
cow(531676) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
domestic cat(101100774) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
dog(612839) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006854 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046101 MISSION® esiRNA esiRNA human KDELR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100603 Rosetta Predictions human pricing
NM_006854 Rosetta Predictions human pricing
NM_001013122 Rosetta Predictions rat pricing
NM_025841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322234 predicted 1176
2 SASI_Hs02_00322235 predicted 1170
3 SASI_Hs02_00322236 predicted 1084
4 SASI_Hs02_00322237 predicted 1089
5 SASI_Hs02_00322238 predicted 1100
6 SASI_Hs02_00322239 predicted 958
7 SASI_Hs02_00322240 predicted 376
8 SASI_Hs02_00322241 predicted 922
9 SASI_Hs02_00322242 predicted 383
10 SASI_Hs02_00322243 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342461 predicted 547
2 SASI_Hs02_00342462 predicted 658
3 SASI_Hs02_00342463 predicted 374
4 SASI_Hs02_00342464 predicted 558
5 SASI_Hs01_00055277 predicted 386
6 SASI_Hs01_00055279 predicted 839
7 SASI_Hs01_00055280 predicted 428
8 SASI_Hs01_00055281 predicted 629
9 SASI_Hs02_00342465 predicted 912
10 SASI_Hs02_00342466 predicted 1064
11 SASI_Hs01_00055272 predicted 681
12 SASI_Hs01_00055273 predicted 212
13 SASI_Hs01_00055274 predicted 704
14 SASI_Hs01_00055275 predicted 396
15 SASI_Hs01_00055276 predicted 405
16 SASI_Hs01_00055278 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055128 predicted 317
2 SASI_Rn01_00055129 predicted 271
3 SASI_Rn01_00055130 predicted 420
4 SASI_Rn01_00055131 predicted 571
5 SASI_Rn01_00055132 predicted 742
6 SASI_Rn01_00055133 predicted 382
7 SASI_Rn01_00055134 predicted 253
8 SASI_Rn01_00055135 predicted 439
9 SASI_Rn01_00055136 predicted 215
10 SASI_Rn01_00055137 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192607 predicted 754
2 SASI_Mm01_00192608 predicted 587
3 SASI_Mm01_00192609 predicted 808
4 SASI_Mm01_00192610 predicted 233
5 SASI_Mm01_00192611 predicted 357
6 SASI_Mm01_00192612 predicted 624
7 SASI_Mm01_00192613 predicted 286
8 SASI_Mm01_00192614 predicted 515
9 SASI_Mm01_00192615 predicted 309
10 SASI_Mm02_00329120 predicted 345
11 SASI_Mm01_00192606 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006854
VALIDATED
KDELR2 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006854.3-1224s21c1
Sequence:CCGGACTTGCATTCCACTATATTTACTCGAGTAAATATAGTGGAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-1100s21c1
Sequence:CCGGGTGAGGAATAAGTGCAAATTTCTCGAGAAATTTGCACTTATTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-272s21c1
Sequence:CCGGGCTTCTGTTTGCACTGGTCTTCTCGAGAAGACCAGTGCAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-713s21c1
Sequence:CCGGCGTAGTCCAGACCATCCTATACTCGAGTATAGGATGGTCTGGACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006854.3-295s21c1
Sequence:CCGGCAACTCGTTACCTGGATCTTTCTCGAGAAAGATCCAGGTAACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006854.3-415s21c1
Sequence:CCGGCCTACGATGGAAATCATGATACTCGAGTATCATGATTTCCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-123s1c1
Sequence:CCGGGCTTCTGTTTGCACTGGTCTTCTCGAGAAGACCAGTGCAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-266s1c1
Sequence:CCGGCCTACGATGGAAATCATGATACTCGAGTATCATGATTTCCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-564s1c1
Sequence:CCGGCGTAGTCCAGACCATCCTATACTCGAGTATAGGATGGTCTGGACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-486s1c1
Sequence:CCGGTCGTGCTTTGTATCTTGTCAACTCGAGTTGACAAGATACAAAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-146s1c1
Sequence:CCGGCAACTCGTTACCTGGATCTTTCTCGAGAAAGATCCAGGTAACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006854
VALIDATED
KDELR2 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006854.3-1224s21c1
Sequence:CCGGACTTGCATTCCACTATATTTACTCGAGTAAATATAGTGGAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-1100s21c1
Sequence:CCGGGTGAGGAATAAGTGCAAATTTCTCGAGAAATTTGCACTTATTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-272s21c1
Sequence:CCGGGCTTCTGTTTGCACTGGTCTTCTCGAGAAGACCAGTGCAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-713s21c1
Sequence:CCGGCGTAGTCCAGACCATCCTATACTCGAGTATAGGATGGTCTGGACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006854.3-295s21c1
Sequence:CCGGCAACTCGTTACCTGGATCTTTCTCGAGAAAGATCCAGGTAACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006854.3-415s21c1
Sequence:CCGGCCTACGATGGAAATCATGATACTCGAGTATCATGATTTCCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-123s1c1
Sequence:CCGGGCTTCTGTTTGCACTGGTCTTCTCGAGAAGACCAGTGCAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-266s1c1
Sequence:CCGGCCTACGATGGAAATCATGATACTCGAGTATCATGATTTCCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-564s1c1
Sequence:CCGGCGTAGTCCAGACCATCCTATACTCGAGTATAGGATGGTCTGGACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-486s1c1
Sequence:CCGGTCGTGCTTTGTATCTTGTCAACTCGAGTTGACAAGATACAAAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-146s1c1
Sequence:CCGGCAACTCGTTACCTGGATCTTTCTCGAGAAAGATCCAGGTAACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006854
VALIDATED
KDELR2 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006854.3-1224s21c1
Sequence:CCGGACTTGCATTCCACTATATTTACTCGAGTAAATATAGTGGAATGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369316    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-1100s21c1
Sequence:CCGGGTGAGGAATAAGTGCAAATTTCTCGAGAAATTTGCACTTATTCCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-272s21c1
Sequence:CCGGGCTTCTGTTTGCACTGGTCTTCTCGAGAAGACCAGTGCAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_006854.3-713s21c1
Sequence:CCGGCGTAGTCCAGACCATCCTATACTCGAGTATAGGATGGTCTGGACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006854.3-295s21c1
Sequence:CCGGCAACTCGTTACCTGGATCTTTCTCGAGAAAGATCCAGGTAACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006854.3-415s21c1
Sequence:CCGGCCTACGATGGAAATCATGATACTCGAGTATCATGATTTCCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-123s1c1
Sequence:CCGGGCTTCTGTTTGCACTGGTCTTCTCGAGAAGACCAGTGCAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-266s1c1
Sequence:CCGGCCTACGATGGAAATCATGATACTCGAGTATCATGATTTCCATCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-564s1c1
Sequence:CCGGCGTAGTCCAGACCATCCTATACTCGAGTATAGGATGGTCTGGACTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-486s1c1
Sequence:CCGGTCGTGCTTTGTATCTTGTCAACTCGAGTTGACAAGATACAAAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006854.2-146s1c1
Sequence:CCGGCAACTCGTTACCTGGATCTTTCTCGAGAAAGATCCAGGTAACGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025841
VALIDATED
KDELR2 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025841.1-1080s1c1
Sequence:CCGGGCACAATAAGTACGAGCCTTTCTCGAGAAAGGCTCGTACTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-391s1c1
Sequence:CCGGCCTATGATGGAAATCACGATACTCGAGTATCGTGATTTCCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025841.1-185s1c1
Sequence:CCGGCGTCATCCTACTGCTGAAGATCTCGAGATCTTCAGCAGTAGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-360s1c1
Sequence:CCGGGTGTACCTGATCTACATGAAACTCGAGTTTCATGTAGATCAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-698s1c1
Sequence:CCGGGACCATTCTCTACTGCGACTTCTCGAGAAGTCGCAGTAGAGAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025841
VALIDATED
KDELR2 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025841.1-1080s1c1
Sequence:CCGGGCACAATAAGTACGAGCCTTTCTCGAGAAAGGCTCGTACTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-391s1c1
Sequence:CCGGCCTATGATGGAAATCACGATACTCGAGTATCGTGATTTCCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025841.1-185s1c1
Sequence:CCGGCGTCATCCTACTGCTGAAGATCTCGAGATCTTCAGCAGTAGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-360s1c1
Sequence:CCGGGTGTACCTGATCTACATGAAACTCGAGTTTCATGTAGATCAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-698s1c1
Sequence:CCGGGACCATTCTCTACTGCGACTTCTCGAGAAGTCGCAGTAGAGAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025841
VALIDATED
KDELR2 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093584    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025841.1-1080s1c1
Sequence:CCGGGCACAATAAGTACGAGCCTTTCTCGAGAAAGGCTCGTACTTATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-391s1c1
Sequence:CCGGCCTATGATGGAAATCACGATACTCGAGTATCGTGATTTCCATCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025841.1-185s1c1
Sequence:CCGGCGTCATCCTACTGCTGAAGATCTCGAGATCTTCAGCAGTAGGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-360s1c1
Sequence:CCGGGTGTACCTGATCTACATGAAACTCGAGTTTCATGTAGATCAGGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025841.1-698s1c1
Sequence:CCGGGACCATTCTCTACTGCGACTTCTCGAGAAGTCGCAGTAGAGAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks