EMAIL THIS PAGE TO A FRIEND

KDELR3

KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3

Synonyms: ERD2L3
Gene ID:
Human(11015) Summary: This gene encodes a member of the KDEL endoplasmic reticulum protein retention receptor family. Retention of resident soluble proteins in the lumen of the endoplasmic reticulum (ER) is achieved in both yeast and animal cells by their continual retrieval from the cis-Golgi, or a pre-Golgi compartment. Sorting of these proteins is dependent on a C-terminal tetrapeptide signal, usually lys-asp-glu-leu (KDEL) in animal cells, and his-asp-glu-leu (HDEL) in S. cerevisiae. This process is mediated by a receptor that recognizes, and binds the tetrapeptide-containing protein, and returns it to the ER. In yeast, the sorting receptor encoded by a single gene, ERD2, is a seven-transmembrane protein. Unlike yeast, several human homologs of the ERD2 gene, constituting the KDEL receptor gene family, have been described. KDELR3 was the third member of the family to be identified. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(105785) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Rat(315131) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Zebrafish(393613) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
cow(509687) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
domestic cat(101080390) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
dog(474509) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
chicken(418026) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
domestic guinea pig(100727776) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
naked mole-rat(101706113) KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006855 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006855 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006855 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006855 Rosetta Predictions human pricing
NM_016657 Rosetta Predictions human pricing
NM_001127546 Rosetta Predictions rat pricing
NM_134090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187815 predicted 256
2 SASI_Hs01_00187816 predicted 502
3 SASI_Hs01_00187818 predicted 410
4 SASI_Hs01_00187819 predicted 369
5 SASI_Hs02_00342467 predicted 510
6 SASI_Hs01_00187821 predicted 317
7 SASI_Hs01_00187822 predicted 242
8 SASI_Hs01_00187823 predicted 268
9 SASI_Hs02_00342468 predicted 383
10 SASI_Hs01_00187824 predicted 284
11 SASI_Hs01_00187817 predicted 362
12 SASI_Hs01_00187820 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173146 predicted 261
2 SASI_Hs01_00173147 predicted 504
3 SASI_Hs01_00173149 predicted 415
4 SASI_Hs01_00173150 predicted 373
5 SASI_Hs02_00349847 predicted 509
6 SASI_Hs01_00173152 predicted 316
7 SASI_Hs01_00173153 predicted 241
8 SASI_Hs01_00173154 predicted 267
9 SASI_Hs02_00349848 predicted 379
10 SASI_Hs01_00173155 predicted 290
11 SASI_Hs01_00173148 predicted 361
12 SASI_Hs01_00173151 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254213 predicted 418
2 SASI_Rn02_00254214 predicted 997
3 SASI_Rn02_00254215 predicted 530
4 SASI_Rn02_00254216 predicted 589
5 SASI_Rn02_00254217 predicted 429
6 SASI_Rn02_00254218 predicted 690
7 SASI_Rn02_00254219 predicted 516
8 SASI_Rn02_00254220 predicted 392
9 SASI_Rn02_00254221 predicted 899
10 SASI_Rn02_00254222 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200570 predicted 548
2 SASI_Mm01_00200571 predicted 239
3 SASI_Mm01_00200572 predicted 836
4 SASI_Mm01_00200573 predicted 933
5 SASI_Mm01_00200574 predicted 661
6 SASI_Mm02_00339315 predicted 595
7 SASI_Mm01_00200575 predicted 761
8 SASI_Mm01_00200576 predicted 628
9 SASI_Mm01_00200577 predicted 867
10 SASI_Mm01_00200578 predicted 301
11 SASI_Mm01_00200579 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134090
VALIDATED
KDELR3 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-1087s1c1
Sequence:CCGGGCAAGCTGTAAGCAGTCCAAACTCGAGTTTGGACTGCTTACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-391s1c1
Sequence:CCGGTGGCCTTTCCTTTCTGGTGAACTCGAGTTCACCAGAAAGGAAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-592s1c1
Sequence:CCGGCCAGACAGAGAACTTCTATGACTCGAGTCATAGAAGTTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-394s1c1
Sequence:CCGGCCTTTCCTTTCTGGTGAACTACTCGAGTAGTTCACCAGAAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-253s1c1
Sequence:CCGGCATCTACAACACAGTGATGAACTCGAGTTCATCACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-592s21c1
Sequence:CCGGCCAGACAGAGAACTTCTATGACTCGAGTCATAGAAGTTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-253s21c1
Sequence:CCGGCATCTACAACACAGTGATGAACTCGAGTTCATCACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134090.1-1087s21c1
Sequence:CCGGGCAAGCTGTAAGCAGTCCAAACTCGAGTTTGGACTGCTTACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-394s21c1
Sequence:CCGGCCTTTCCTTTCTGGTGAACTACTCGAGTAGTTCACCAGAAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134090
VALIDATED
KDELR3 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-1087s1c1
Sequence:CCGGGCAAGCTGTAAGCAGTCCAAACTCGAGTTTGGACTGCTTACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-391s1c1
Sequence:CCGGTGGCCTTTCCTTTCTGGTGAACTCGAGTTCACCAGAAAGGAAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-592s1c1
Sequence:CCGGCCAGACAGAGAACTTCTATGACTCGAGTCATAGAAGTTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-394s1c1
Sequence:CCGGCCTTTCCTTTCTGGTGAACTACTCGAGTAGTTCACCAGAAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-253s1c1
Sequence:CCGGCATCTACAACACAGTGATGAACTCGAGTTCATCACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-592s21c1
Sequence:CCGGCCAGACAGAGAACTTCTATGACTCGAGTCATAGAAGTTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-253s21c1
Sequence:CCGGCATCTACAACACAGTGATGAACTCGAGTTCATCACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134090.1-1087s21c1
Sequence:CCGGGCAAGCTGTAAGCAGTCCAAACTCGAGTTTGGACTGCTTACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-394s21c1
Sequence:CCGGCCTTTCCTTTCTGGTGAACTACTCGAGTAGTTCACCAGAAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134090
VALIDATED
KDELR3 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093589    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-1087s1c1
Sequence:CCGGGCAAGCTGTAAGCAGTCCAAACTCGAGTTTGGACTGCTTACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-391s1c1
Sequence:CCGGTGGCCTTTCCTTTCTGGTGAACTCGAGTTCACCAGAAAGGAAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-592s1c1
Sequence:CCGGCCAGACAGAGAACTTCTATGACTCGAGTCATAGAAGTTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-394s1c1
Sequence:CCGGCCTTTCCTTTCTGGTGAACTACTCGAGTAGTTCACCAGAAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134090.1-253s1c1
Sequence:CCGGCATCTACAACACAGTGATGAACTCGAGTTCATCACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-592s21c1
Sequence:CCGGCCAGACAGAGAACTTCTATGACTCGAGTCATAGAAGTTCTCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-253s21c1
Sequence:CCGGCATCTACAACACAGTGATGAACTCGAGTTCATCACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134090.1-1087s21c1
Sequence:CCGGGCAAGCTGTAAGCAGTCCAAACTCGAGTTTGGACTGCTTACAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134090.1-394s21c1
Sequence:CCGGCCTTTCCTTTCTGGTGAACTACTCGAGTAGTTCACCAGAAAGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006855
VALIDATED
KDELR3 MISSION shRNA Bacterial Glycerol Stock
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-708s1c1
Sequence:CCGGAGTAGTACAAACCATCTTCTACTCGAGTAGAAGATGGTTTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-588s1c1
Sequence:CCGGTGAGACCATAACTACTCACTACTCGAGTAGTGAGTAGTTATGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-327s1c1
Sequence:CCGGCATCTACAACACAGTAATGAACTCGAGTTCATTACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-660s1c1
Sequence:CCGGGCGGTACCAGACTGAGAATTTCTCGAGAAATTCTCAGTCTGGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-511s1c1
Sequence:CCGGCTCTGGACTTTCTCTATCTATCTCGAGATAGATAGAGAAAGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-1059s21c1
Sequence:CCGGGGTGTCTTACCGACGAAATAACTCGAGTTATTTCGTCGGTAAGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-327s21c1
Sequence:CCGGCATCTACAACACAGTAATGAACTCGAGTTCATTACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-708s21c1
Sequence:CCGGAGTAGTACAAACCATCTTCTACTCGAGTAGAAGATGGTTTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-660s21c1
Sequence:CCGGGCGGTACCAGACTGAGAATTTCTCGAGAAATTCTCAGTCTGGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006855.2-357s21c1
Sequence:CCGGTCTCCTCTGTGCCTATGTTACCTCGAGGTAACATAGGCACAGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006855
VALIDATED
KDELR3 MISSION shRNA shRNA Plasmid DNA
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-708s1c1
Sequence:CCGGAGTAGTACAAACCATCTTCTACTCGAGTAGAAGATGGTTTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-588s1c1
Sequence:CCGGTGAGACCATAACTACTCACTACTCGAGTAGTGAGTAGTTATGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-327s1c1
Sequence:CCGGCATCTACAACACAGTAATGAACTCGAGTTCATTACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-660s1c1
Sequence:CCGGGCGGTACCAGACTGAGAATTTCTCGAGAAATTCTCAGTCTGGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-511s1c1
Sequence:CCGGCTCTGGACTTTCTCTATCTATCTCGAGATAGATAGAGAAAGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-1059s21c1
Sequence:CCGGGGTGTCTTACCGACGAAATAACTCGAGTTATTTCGTCGGTAAGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-327s21c1
Sequence:CCGGCATCTACAACACAGTAATGAACTCGAGTTCATTACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-708s21c1
Sequence:CCGGAGTAGTACAAACCATCTTCTACTCGAGTAGAAGATGGTTTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-660s21c1
Sequence:CCGGGCGGTACCAGACTGAGAATTTCTCGAGAAATTCTCAGTCTGGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006855.2-357s21c1
Sequence:CCGGTCTCCTCTGTGCCTATGTTACCTCGAGGTAACATAGGCACAGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006855
VALIDATED
KDELR3 MISSION shRNA Lentiviral Transduction Particles
KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-708s1c1
Sequence:CCGGAGTAGTACAAACCATCTTCTACTCGAGTAGAAGATGGTTTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-588s1c1
Sequence:CCGGTGAGACCATAACTACTCACTACTCGAGTAGTGAGTAGTTATGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-327s1c1
Sequence:CCGGCATCTACAACACAGTAATGAACTCGAGTTCATTACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-660s1c1
Sequence:CCGGGCGGTACCAGACTGAGAATTTCTCGAGAAATTCTCAGTCTGGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006855.2-511s1c1
Sequence:CCGGCTCTGGACTTTCTCTATCTATCTCGAGATAGATAGAGAAAGTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-1059s21c1
Sequence:CCGGGGTGTCTTACCGACGAAATAACTCGAGTTATTTCGTCGGTAAGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-327s21c1
Sequence:CCGGCATCTACAACACAGTAATGAACTCGAGTTCATTACTGTGTTGTAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-708s21c1
Sequence:CCGGAGTAGTACAAACCATCTTCTACTCGAGTAGAAGATGGTTTGTACTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006855.2-660s21c1
Sequence:CCGGGCGGTACCAGACTGAGAATTTCTCGAGAAATTCTCAGTCTGGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006855.2-357s21c1
Sequence:CCGGTCTCCTCTGTGCCTATGTTACCTCGAGGTAACATAGGCACAGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks