EMAIL THIS PAGE TO A FRIEND

KDM3A

lysine (K)-specific demethylase 3A

Synonyms: JHDM2A JHMD2A JMJD1 JMJD1A TSGA
Gene ID:
Human(55818) Summary: This gene encodes a zinc finger protein that contains a jumonji domain and may play a role in hormone-dependent transcriptional activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(104263) lysine (K)-specific demethylase 3A
Rat(312440) lysine (K)-specific demethylase 3A
chicken(422917) lysine (K)-specific demethylase 3A
cow(536073) lysine (K)-specific demethylase 3A
Horse(100066939) lysine (K)-specific demethylase 3A
domestic cat(101094014) lysine (K)-specific demethylase 3A
dog(475763) lysine (K)-specific demethylase 3A
sheep(101106756) lysine (K)-specific demethylase 3A
Domestic Rabbit(100358329) lysine (K)-specific demethylase 3A
domestic guinea pig(100727212) lysine (K)-specific demethylase 3A
naked mole-rat(101723328) lysine (K)-specific demethylase 3A
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306223 ANTI-JHDM2A(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB1306217 ANTI-JHDM2A(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB2108478 Anti-JMJD1A IgG fraction of antiserum human, pig, horse, mouse, rat, canine, bovine, rabbit, guinea pig, zebrafish
immunohistochemistry, western blot pricing
AV32911 Anti-JMJD1A antibody produced in rabbit IgG fraction of antiserum rabbit, canine, rat, mouse, bovine, guinea pig, human, horse
immunohistochemistry, western blot pricing
SAB3500093 Anti-JMJD1A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA055543 Anti-KDM3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA065162 Anti-KDM3A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB5300073 Monoclonal Anti-KDM3A antibody produced in mouse clone 1E12, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300074 Monoclonal Anti-KDM3A antibody produced in mouse clone 2E1, ascites fluid human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001038695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001038695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001038695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018433 Rosetta Predictions human pricing
NM_175764 Rosetta Predictions rat pricing
NM_001038695 Rosetta Predictions mouse pricing
NM_173001 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240496 predicted 3634
2 SASI_Hs02_00351959 predicted 1730
3 SASI_Hs02_00351960 predicted 1991
4 SASI_Hs01_00240498 predicted 1133
5 SASI_Hs02_00351961 predicted 543
6 SASI_Hs01_00240499 predicted 580
7 SASI_Hs01_00240500 predicted 4100
8 SASI_Hs01_00240501 predicted 2035
9 SASI_Hs02_00351962 predicted 2488
10 SASI_Hs01_00240502 predicted 3659
11 SASI_Hs01_00240497 predicted 2405
12 SASI_Hs01_00240503 predicted 1406
13 SASI_Hs01_00240504 predicted 596
14 SASI_Hs01_00240505 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175764 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058058 predicted 3397
2 SASI_Rn02_00269522 predicted 2823
3 SASI_Rn02_00269523 predicted 3706
4 SASI_Rn01_00058060 predicted 911
5 SASI_Rn02_00269524 predicted 3340
6 SASI_Rn01_00058061 predicted 1803
7 SASI_Rn01_00058062 predicted 3808
8 SASI_Rn01_00058063 predicted 1578
9 SASI_Rn01_00058065 predicted 694
10 SASI_Rn02_00269525 predicted 2824
11 SASI_Rn01_00058059 predicted 3430
12 SASI_Rn01_00058064 predicted 2707
13 SASI_Rn01_00058066 predicted 3588
14 SASI_Rn01_00058067 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177804 predicted 3195
2 SASI_Mm01_00177805 predicted 3527
3 SASI_Mm01_00177806 predicted 1669
4 SASI_Mm02_00289670 predicted 560
5 SASI_Mm01_00177808 predicted 2812
6 SASI_Mm02_00289671 predicted 1556
7 SASI_Mm02_00289672 predicted 1960
8 SASI_Mm01_00177809 predicted 1148
9 SASI_Mm01_00177811 predicted 3053
10 SASI_Mm01_00177812 predicted 2963
11 SASI_Mm01_00177807 predicted 1848
12 SASI_Mm01_00177810 predicted 3059
13 SASI_Mm01_00177813 predicted 2121
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115429 predicted 3226
2 SASI_Mm01_00115430 predicted 3565
3 SASI_Mm01_00115431 predicted 1709
4 SASI_Mm02_00345045 predicted 597
5 SASI_Mm01_00115433 predicted 2843
6 SASI_Mm02_00345046 predicted 1594
7 SASI_Mm02_00345047 predicted 2000
8 SASI_Mm01_00115434 predicted 1188
9 SASI_Mm01_00115436 predicted 3089
10 SASI_Mm01_00115437 predicted 3007
11 SASI_Mm01_00115432 predicted 2291
12 SASI_Mm01_00115435 predicted 3501
13 SASI_Mm01_00115438 predicted 2559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018433
VALIDATED
KDM3A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 3A
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-2916s21c1
Sequence:GTACCGGCACAGTCCTCCATACGTTTAACTCGAGTTAAACGTATGGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-795s21c1
Sequence:CCGGTCGACTTTCTCTTACGGATAACTCGAGTTATCCGTAAGAGAAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018433.5-4600s21c1
Sequence:CCGGACAACTTAGATTGGGTTTATACTCGAGTATAAACCCAATCTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018433.5-841s21c1
Sequence:CCGGGCTTTGATTGTGAAGCATTTACTCGAGTAAATGCTTCACAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018433.5-4719s21c1
Sequence:GTACCGGAGCTAATGTTGCAGTTCTTATCTCGAGATAAGAACTGCAACATTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-3648s21c1
Sequence:GTACCGGCACTCCTGAAGATCGGAAATACTCGAGTATTTCCGATCTTCAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-1704s21c1
Sequence:CCGGCAATAGTGATAGCCCTAATAACTCGAGTTATTAGGGCTATCACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-4185s21c1
Sequence:CCGGTCATACCAATCACGAAGATAACTCGAGTTATCTTCGTGATTGGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-1942s21c1
Sequence:GTACCGGATCGTGGCACAGTTGCCTAAACTCGAGTTTAGGCAACTGTGCCACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018433.2-3447s1c1
Sequence:CCGGCCCAAGATGTATAATGCTTATCTCGAGATAAGCATTATACATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-2753s1c1
Sequence:CCGGCCATACGTTTAACAGCACAATCTCGAGATTGTGCTGTTAAACGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-1544s1c1
Sequence:CCGGCCCTAATAACTGTTCAGGAAACTCGAGTTTCCTGAACAGTTATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-3787s1c1
Sequence:CCGGGCTGGTATTTAGACCGATCATCTCGAGATGATCGGTCTAAATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-669s1c1
Sequence:CCGGGCTTTGATTGTGAAGCATTTACTCGAGTAAATGCTTCACAATCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018433
VALIDATED
KDM3A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 3A
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-2916s21c1
Sequence:GTACCGGCACAGTCCTCCATACGTTTAACTCGAGTTAAACGTATGGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-795s21c1
Sequence:CCGGTCGACTTTCTCTTACGGATAACTCGAGTTATCCGTAAGAGAAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018433.5-4600s21c1
Sequence:CCGGACAACTTAGATTGGGTTTATACTCGAGTATAAACCCAATCTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018433.5-841s21c1
Sequence:CCGGGCTTTGATTGTGAAGCATTTACTCGAGTAAATGCTTCACAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018433.5-4719s21c1
Sequence:GTACCGGAGCTAATGTTGCAGTTCTTATCTCGAGATAAGAACTGCAACATTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-3648s21c1
Sequence:GTACCGGCACTCCTGAAGATCGGAAATACTCGAGTATTTCCGATCTTCAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-1704s21c1
Sequence:CCGGCAATAGTGATAGCCCTAATAACTCGAGTTATTAGGGCTATCACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-4185s21c1
Sequence:CCGGTCATACCAATCACGAAGATAACTCGAGTTATCTTCGTGATTGGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-1942s21c1
Sequence:GTACCGGATCGTGGCACAGTTGCCTAAACTCGAGTTTAGGCAACTGTGCCACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018433.2-3447s1c1
Sequence:CCGGCCCAAGATGTATAATGCTTATCTCGAGATAAGCATTATACATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-2753s1c1
Sequence:CCGGCCATACGTTTAACAGCACAATCTCGAGATTGTGCTGTTAAACGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-1544s1c1
Sequence:CCGGCCCTAATAACTGTTCAGGAAACTCGAGTTTCCTGAACAGTTATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-3787s1c1
Sequence:CCGGGCTGGTATTTAGACCGATCATCTCGAGATGATCGGTCTAAATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-669s1c1
Sequence:CCGGGCTTTGATTGTGAAGCATTTACTCGAGTAAATGCTTCACAATCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018433
VALIDATED
KDM3A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 3A
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-2916s21c1
Sequence:GTACCGGCACAGTCCTCCATACGTTTAACTCGAGTTAAACGTATGGAGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-795s21c1
Sequence:CCGGTCGACTTTCTCTTACGGATAACTCGAGTTATCCGTAAGAGAAAGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018433.5-4600s21c1
Sequence:CCGGACAACTTAGATTGGGTTTATACTCGAGTATAAACCCAATCTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018433.5-841s21c1
Sequence:CCGGGCTTTGATTGTGAAGCATTTACTCGAGTAAATGCTTCACAATCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018433.5-4719s21c1
Sequence:GTACCGGAGCTAATGTTGCAGTTCTTATCTCGAGATAAGAACTGCAACATTAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-3648s21c1
Sequence:GTACCGGCACTCCTGAAGATCGGAAATACTCGAGTATTTCCGATCTTCAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-1704s21c1
Sequence:CCGGCAATAGTGATAGCCCTAATAACTCGAGTTATTAGGGCTATCACTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-4185s21c1
Sequence:CCGGTCATACCAATCACGAAGATAACTCGAGTTATCTTCGTGATTGGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018433.5-1942s21c1
Sequence:GTACCGGATCGTGGCACAGTTGCCTAAACTCGAGTTTAGGCAACTGTGCCACGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018433.2-3447s1c1
Sequence:CCGGCCCAAGATGTATAATGCTTATCTCGAGATAAGCATTATACATCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-2753s1c1
Sequence:CCGGCCATACGTTTAACAGCACAATCTCGAGATTGTGCTGTTAAACGTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-1544s1c1
Sequence:CCGGCCCTAATAACTGTTCAGGAAACTCGAGTTTCCTGAACAGTTATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-3787s1c1
Sequence:CCGGGCTGGTATTTAGACCGATCATCTCGAGATGATCGGTCTAAATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018433.2-669s1c1
Sequence:CCGGGCTTTGATTGTGAAGCATTTACTCGAGTAAATGCTTCACAATCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001038695
VALIDATED
KDM3A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 3A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3403s21c1
Sequence:CCGGGCGCCACATCAGGTTCATAACCTCGAGGTTATGAACCTGATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3286s21c1
Sequence:CCGGCACGATCAGAGCTGGTATTTACTCGAGTAAATACCAGCTCTGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3174s21c1
Sequence:CCGGAGGAGCCCTTTGGCACATATACTCGAGTATATGTGCCAAAGGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-2852s21c1
Sequence:CCGGATGATCTGATGGCCAACATTCCTCGAGGAATGTTGGCCATCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-488s21c1
Sequence:CCGGGAAGTTCCTGAGCAAGTTATTCTCGAGAATAACTTGCTCAGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-3509s21c1
Sequence:CCGGACTCCAGAGGATCGGAAATATCTCGAGATATTTCCGATCCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-4489s21c1
Sequence:CCGGCTGCGAAGTTTCGTTGGATTTCTCGAGAAATCCAACGAAACTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-649s21c1
Sequence:CCGGTCGGCTTTCCCTTACTGATAACTCGAGTTATCAGTAAGGGAAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001038695
VALIDATED
KDM3A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 3A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3403s21c1
Sequence:CCGGGCGCCACATCAGGTTCATAACCTCGAGGTTATGAACCTGATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3286s21c1
Sequence:CCGGCACGATCAGAGCTGGTATTTACTCGAGTAAATACCAGCTCTGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3174s21c1
Sequence:CCGGAGGAGCCCTTTGGCACATATACTCGAGTATATGTGCCAAAGGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-2852s21c1
Sequence:CCGGATGATCTGATGGCCAACATTCCTCGAGGAATGTTGGCCATCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-488s21c1
Sequence:CCGGGAAGTTCCTGAGCAAGTTATTCTCGAGAATAACTTGCTCAGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-3509s21c1
Sequence:CCGGACTCCAGAGGATCGGAAATATCTCGAGATATTTCCGATCCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-4489s21c1
Sequence:CCGGCTGCGAAGTTTCGTTGGATTTCTCGAGAAATCCAACGAAACTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-649s21c1
Sequence:CCGGTCGGCTTTCCCTTACTGATAACTCGAGTTATCAGTAAGGGAAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001038695
VALIDATED
KDM3A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 3A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3403s21c1
Sequence:CCGGGCGCCACATCAGGTTCATAACCTCGAGGTTATGAACCTGATGTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3286s21c1
Sequence:CCGGCACGATCAGAGCTGGTATTTACTCGAGTAAATACCAGCTCTGATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-3174s21c1
Sequence:CCGGAGGAGCCCTTTGGCACATATACTCGAGTATATGTGCCAAAGGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.1-2852s21c1
Sequence:CCGGATGATCTGATGGCCAACATTCCTCGAGGAATGTTGGCCATCAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-488s21c1
Sequence:CCGGGAAGTTCCTGAGCAAGTTATTCTCGAGAATAACTTGCTCAGGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-3509s21c1
Sequence:CCGGACTCCAGAGGATCGGAAATATCTCGAGATATTTCCGATCCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-4489s21c1
Sequence:CCGGCTGCGAAGTTTCGTTGGATTTCTCGAGAAATCCAACGAAACTTCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001038695.2-649s21c1
Sequence:CCGGTCGGCTTTCCCTTACTGATAACTCGAGTTATCAGTAAGGGAAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks