EMAIL THIS PAGE TO A FRIEND

KDM3B

lysine (K)-specific demethylase 3B

Synonyms: 5qNCA C5orf7 JMJD1B NET22
Gene ID:
Mouse(277250) KDM3B lysine (K)-specific demethylase 3B
Rat(682469) lysine (K)-specific demethylase 3B
domestic guinea pig(100730299) lysine (K)-specific demethylase 3B
naked mole-rat(101713897) lysine (K)-specific demethylase 3B
sheep(101111280) lysine (K)-specific demethylase 3B
Domestic Rabbit(100346181) lysine (K)-specific demethylase 3B
Zebrafish(569458) lysine (K)-specific demethylase 3B
chicken(100859412) lysine (K)-specific demethylase 3B
cow(100848816) lysine (K)-specific demethylase 3B
Horse(100062288) lysine (K)-specific demethylase 3B
domestic cat(101087899) lysine (K)-specific demethylase 3B
dog(474695) lysine (K)-specific demethylase 3B
157 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016604 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016604 Rosetta Predictions human pricing
XM_001061636 Rosetta Predictions rat pricing
NM_001081256 Rosetta Predictions mouse pricing
XM_619530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217809 predicted 3023
2 SASI_Hs01_00217810 predicted 3783
3 SASI_Hs02_00349740 predicted 4716
4 SASI_Hs02_00349741 predicted 3567
5 SASI_Hs01_00217811 predicted 1789
6 SASI_Hs01_00217812 predicted 877
7 SASI_Hs01_00217814 predicted 4756
8 SASI_Hs01_00217815 predicted 610
9 SASI_Hs01_00217816 predicted 1773
10 SASI_Hs01_00217818 predicted 4604
11 SASI_Hs01_00217813 predicted 2984
12 SASI_Hs01_00217817 predicted 3588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00300807 predicted 695
2 SASI_Rn02_00300808 predicted 3363
3 SASI_Rn02_00300809 predicted 4669
4 SASI_Rn02_00300810 predicted 2198
5 SASI_Rn02_00300811 predicted 3372
6 SASI_Rn02_00300812 predicted 4706
7 SASI_Rn02_00300813 predicted 393
8 SASI_Rn02_00300814 predicted 5230
9 SASI_Rn02_00300815 predicted 4359
10 SASI_Rn02_00300816 predicted 4561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296697 predicted 2321
2 SASI_Mm02_00296698 predicted 1730
3 SASI_Mm02_00296699 predicted 4687
4 SASI_Mm02_00296700 predicted 2833
5 SASI_Mm02_00296701 predicted 5346
6 SASI_Mm02_00296702 predicted 4957
7 SASI_Mm02_00296703 predicted 704
8 SASI_Mm02_00296704 predicted 4790
9 SASI_Mm02_00296705 predicted 3492
10 SASI_Mm02_00296706 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00220403 predicted 2328
2 SASI_Mm01_00220404 predicted 1733
3 SASI_Mm01_00220405 predicted 4690
4 SASI_Mm01_00220406 predicted 2834
5 SASI_Mm01_00220407 predicted 5357
6 SASI_Mm01_00220408 predicted 4960
7 SASI_Mm01_00220409 predicted 715
8 SASI_Mm01_00220410 predicted 4796
9 SASI_Mm01_00220411 predicted 3503
10 SASI_Mm01_00220412 predicted 1838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016604
VALIDATED
KDM3B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 3B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016604.2-4564s1c1
Sequence:CCGGCCGATGTGAAAGTTCGGGATTCTCGAGAATCCCGAACTTTCACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016604.2-572s1c1
Sequence:CCGGCCTTGTAGATAAACTGGGTTTCTCGAGAAACCCAGTTTATCTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016604.2-390s1c1
Sequence:CCGGGCGATCTTTGTAGAATTTGATCTCGAGATCAAATTCTACAAAGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016604.2-4896s1c1
Sequence:CCGGGCTGTTAATGTGATGGTGTATCTCGAGATACACCATCACATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-5934s21c1
Sequence:GTACCGGTGCACGTGACCTCTGACAAAGCTCGAGCTTTGTCAGAGGTCACGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-1628s21c1
Sequence:CCGGCCCTAGTTCATCGCAACCTTTCTCGAGAAAGGTTGCGATGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-390s21c1
Sequence:CCGGGCGATCTTTGTAGAATTTGATCTCGAGATCAAATTCTACAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-4822s21c1
Sequence:CCGGACAACGCCTATGGGTTGATAACTCGAGTTATCAACCCATAGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-866s21c1
Sequence:CCGGGGACTCCATCACTCGTCTTATCTCGAGATAAGACGAGTGATGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016604.3-5869s21c1
Sequence:CCGGCACATAACTGGTACAAGTATGCTCGAGCATACTTGTACCAGTTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-5507s21c1
Sequence:GTACCGGCCTCTGTGAAGCAGGTCTTTCCTCGAGGAAAGACCTGCTTCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016604
VALIDATED
KDM3B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 3B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016604.2-4564s1c1
Sequence:CCGGCCGATGTGAAAGTTCGGGATTCTCGAGAATCCCGAACTTTCACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016604.2-572s1c1
Sequence:CCGGCCTTGTAGATAAACTGGGTTTCTCGAGAAACCCAGTTTATCTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016604.2-390s1c1
Sequence:CCGGGCGATCTTTGTAGAATTTGATCTCGAGATCAAATTCTACAAAGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016604.2-4896s1c1
Sequence:CCGGGCTGTTAATGTGATGGTGTATCTCGAGATACACCATCACATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-5934s21c1
Sequence:GTACCGGTGCACGTGACCTCTGACAAAGCTCGAGCTTTGTCAGAGGTCACGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-1628s21c1
Sequence:CCGGCCCTAGTTCATCGCAACCTTTCTCGAGAAAGGTTGCGATGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-390s21c1
Sequence:CCGGGCGATCTTTGTAGAATTTGATCTCGAGATCAAATTCTACAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-4822s21c1
Sequence:CCGGACAACGCCTATGGGTTGATAACTCGAGTTATCAACCCATAGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-866s21c1
Sequence:CCGGGGACTCCATCACTCGTCTTATCTCGAGATAAGACGAGTGATGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016604.3-5869s21c1
Sequence:CCGGCACATAACTGGTACAAGTATGCTCGAGCATACTTGTACCAGTTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-5507s21c1
Sequence:GTACCGGCCTCTGTGAAGCAGGTCTTTCCTCGAGGAAAGACCTGCTTCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016604
VALIDATED
KDM3B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 3B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_016604.2-4564s1c1
Sequence:CCGGCCGATGTGAAAGTTCGGGATTCTCGAGAATCCCGAACTTTCACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016604.2-572s1c1
Sequence:CCGGCCTTGTAGATAAACTGGGTTTCTCGAGAAACCCAGTTTATCTACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_016604.2-390s1c1
Sequence:CCGGGCGATCTTTGTAGAATTTGATCTCGAGATCAAATTCTACAAAGATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016604.2-4896s1c1
Sequence:CCGGGCTGTTAATGTGATGGTGTATCTCGAGATACACCATCACATTAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-5934s21c1
Sequence:GTACCGGTGCACGTGACCTCTGACAAAGCTCGAGCTTTGTCAGAGGTCACGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-1628s21c1
Sequence:CCGGCCCTAGTTCATCGCAACCTTTCTCGAGAAAGGTTGCGATGAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-390s21c1
Sequence:CCGGGCGATCTTTGTAGAATTTGATCTCGAGATCAAATTCTACAAAGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-4822s21c1
Sequence:CCGGACAACGCCTATGGGTTGATAACTCGAGTTATCAACCCATAGGCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-866s21c1
Sequence:CCGGGGACTCCATCACTCGTCTTATCTCGAGATAAGACGAGTGATGGAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016604.3-5869s21c1
Sequence:CCGGCACATAACTGGTACAAGTATGCTCGAGCATACTTGTACCAGTTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_016604.3-5507s21c1
Sequence:GTACCGGCCTCTGTGAAGCAGGTCTTTCCTCGAGGAAAGACCTGCTTCACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081256
VALIDATED
KDM3B MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 3B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-6107s21c1
Sequence:GTACCGGGTTAGTCTTCCTTTCGATAAACTCGAGTTTATCGAAAGGAAGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-4809s21c1
Sequence:CCGGAGATGTGTCAGACGCTGTTAACTCGAGTTAACAGCGTCTGACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-4479s21c1
Sequence:CCGGTGCTATCATTTCCGATGTTAACTCGAGTTAACATCGGAAATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-3707s21c1
Sequence:CCGGCAGAAGGTTCTGCGTCAAATACTCGAGTATTTGACGCAGAACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-2767s21c1
Sequence:CCGGGTGCTGAAGGACGTGAGTAAACTCGAGTTTACTCACGTCCTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081256
VALIDATED
KDM3B MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 3B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-6107s21c1
Sequence:GTACCGGGTTAGTCTTCCTTTCGATAAACTCGAGTTTATCGAAAGGAAGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-4809s21c1
Sequence:CCGGAGATGTGTCAGACGCTGTTAACTCGAGTTAACAGCGTCTGACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-4479s21c1
Sequence:CCGGTGCTATCATTTCCGATGTTAACTCGAGTTAACATCGGAAATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-3707s21c1
Sequence:CCGGCAGAAGGTTCTGCGTCAAATACTCGAGTATTTGACGCAGAACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-2767s21c1
Sequence:CCGGGTGCTGAAGGACGTGAGTAAACTCGAGTTTACTCACGTCCTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081256
VALIDATED
KDM3B MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 3B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218542    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-6107s21c1
Sequence:GTACCGGGTTAGTCTTCCTTTCGATAAACTCGAGTTTATCGAAAGGAAGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-4809s21c1
Sequence:CCGGAGATGTGTCAGACGCTGTTAACTCGAGTTAACAGCGTCTGACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-4479s21c1
Sequence:CCGGTGCTATCATTTCCGATGTTAACTCGAGTTAACATCGGAAATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-3707s21c1
Sequence:CCGGCAGAAGGTTCTGCGTCAAATACTCGAGTATTTGACGCAGAACCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081256.1-2767s21c1
Sequence:CCGGGTGCTGAAGGACGTGAGTAAACTCGAGTTTACTCACGTCCTTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks