EMAIL THIS PAGE TO A FRIEND

KDM4C

lysine (K)-specific demethylase 4C

Synonyms: GASC1 JHDM3C JMJD2C TDRD14C bA146B14.1
Gene ID:
Human(23081) Summary: This gene is a member of the Jumonji domain 2 (JMJD2) family and encodes a protein with one JmjC domain, one JmjN domain, two PHD-type zinc fingers, and two Tudor domains. This nuclear protein functions as a trimethylation-specific demethylase, converting specific trimethylated histone residues to the dimethylated form. Chromosomal aberrations and increased transcriptional expression of this gene are associated with esophageal squamous cell carcinoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(76804) lysine (K)-specific demethylase 4C
Rat(298144) lysine (K)-specific demethylase 4C
sheep(101117992) lysine (K)-specific demethylase 4C
Domestic Rabbit(100343440) lysine (K)-specific demethylase 4C
domestic guinea pig(100719980) lysine (K)-specific demethylase 4C
naked mole-rat(101698040) lysine (K)-specific demethylase 4C
chicken(427231) lysine (K)-specific demethylase 4C
Horse(100060699) lysine (K)-specific demethylase 4C
cow(535671) lysine (K)-specific demethylase 4C
dog(474704) lysine (K)-specific demethylase 4C
domestic cat(101100423) lysine (K)-specific demethylase 4C
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015061 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015061 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015061 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015061 Rosetta Predictions human pricing
NM_144787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015061 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068415 predicted 3132
2 SASI_Hs01_00068416 predicted 2610
3 SASI_Hs01_00068417 predicted 3204
4 SASI_Hs01_00068418 predicted 3275
5 SASI_Hs01_00068419 predicted 2738
6 SASI_Hs01_00068420 predicted 3123
7 SASI_Hs02_00346916 predicted 2754
8 SASI_Hs01_00068423 predicted 3571
9 SASI_Hs02_00346917 predicted 750
10 SASI_Hs02_00346918 predicted 1492
11 SASI_Hs01_00068421 predicted 1157
12 SASI_Hs01_00068422 predicted 2282
13 SASI_Hs01_00068424 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172509 predicted 3040
2 SASI_Mm02_00340128 predicted 3230
3 SASI_Mm01_00172510 predicted 2988
4 SASI_Mm01_00172511 predicted 1432
5 SASI_Mm01_00172512 predicted 2871
6 SASI_Mm01_00172513 predicted 3167
7 SASI_Mm01_00172514 predicted 581
8 SASI_Mm01_00172515 predicted 1953
9 SASI_Mm01_00172516 predicted 1332
10 SASI_Mm01_00172518 predicted 2927
11 SASI_Mm01_00172517 predicted 2172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144787
VALIDATED
KDM4C MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144787.1-3475s21c1
Sequence:CCGGGCAACCAAGAAGAGACATATTCTCGAGAATATGTCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-3049s21c1
Sequence:CCGGCCTATATGTATCAGGTTGAATCTCGAGATTCAACCTGATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-2851s21c1
Sequence:CCGGGCAGAGTGATAGATGTGACATCTCGAGATGTCACATCTATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-3024s21c1
Sequence:CCGGGCAAAGTATCTTGGATCAAATCTCGAGATTTGATCCAAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144787.1-3475s1c1
Sequence:CCGGGCAACCAAGAAGAGACATATTCTCGAGAATATGTCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-3049s1c1
Sequence:CCGGCCTATATGTATCAGGTTGAATCTCGAGATTCAACCTGATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-3024s1c1
Sequence:CCGGGCAAAGTATCTTGGATCAAATCTCGAGATTTGATCCAAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144787.1-470s1c1
Sequence:CCGGGCTGGCTAACAGCAGCAAATACTCGAGTATTTGCTGCTGTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-2851s1c1
Sequence:CCGGGCAGAGTGATAGATGTGACATCTCGAGATGTCACATCTATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144787
VALIDATED
KDM4C MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144787.1-3475s21c1
Sequence:CCGGGCAACCAAGAAGAGACATATTCTCGAGAATATGTCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-3049s21c1
Sequence:CCGGCCTATATGTATCAGGTTGAATCTCGAGATTCAACCTGATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-2851s21c1
Sequence:CCGGGCAGAGTGATAGATGTGACATCTCGAGATGTCACATCTATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-3024s21c1
Sequence:CCGGGCAAAGTATCTTGGATCAAATCTCGAGATTTGATCCAAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144787.1-3475s1c1
Sequence:CCGGGCAACCAAGAAGAGACATATTCTCGAGAATATGTCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-3049s1c1
Sequence:CCGGCCTATATGTATCAGGTTGAATCTCGAGATTCAACCTGATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-3024s1c1
Sequence:CCGGGCAAAGTATCTTGGATCAAATCTCGAGATTTGATCCAAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144787.1-470s1c1
Sequence:CCGGGCTGGCTAACAGCAGCAAATACTCGAGTATTTGCTGCTGTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-2851s1c1
Sequence:CCGGGCAGAGTGATAGATGTGACATCTCGAGATGTCACATCTATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144787
VALIDATED
KDM4C MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144787.1-3475s21c1
Sequence:CCGGGCAACCAAGAAGAGACATATTCTCGAGAATATGTCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-3049s21c1
Sequence:CCGGCCTATATGTATCAGGTTGAATCTCGAGATTCAACCTGATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-2851s21c1
Sequence:CCGGGCAGAGTGATAGATGTGACATCTCGAGATGTCACATCTATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144787.1-3024s21c1
Sequence:CCGGGCAAAGTATCTTGGATCAAATCTCGAGATTTGATCCAAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144787.1-3475s1c1
Sequence:CCGGGCAACCAAGAAGAGACATATTCTCGAGAATATGTCTCTTCTTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-3049s1c1
Sequence:CCGGCCTATATGTATCAGGTTGAATCTCGAGATTCAACCTGATACATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-3024s1c1
Sequence:CCGGGCAAAGTATCTTGGATCAAATCTCGAGATTTGATCCAAGATACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144787.1-470s1c1
Sequence:CCGGGCTGGCTAACAGCAGCAAATACTCGAGTATTTGCTGCTGTTAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144787.1-2851s1c1
Sequence:CCGGGCAGAGTGATAGATGTGACATCTCGAGATGTCACATCTATCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015061
VALIDATED
KDM4C MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015061.2-4140s21c1
Sequence:CCGGCAGCGGGTAGGGCGATAATTTCTCGAGAAATTATCGCCCTACCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-2045s21c1
Sequence:CCGGGCTATGAGAAGCCCGAGAAATCTCGAGATTTCTCGGGCTTCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-3232s21c1
Sequence:CCGGCATCGGAACACCCGGTATTACCTCGAGGTAATACCGGGTGTTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-3141s21c1
Sequence:CCGGCATTACATGCTTTCGACATAACTCGAGTTATGTCGAAAGCATGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-903s21c1
Sequence:CCGGATACTTGGATTACGAAGATTTCTCGAGAAATCTTCGTAATCCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015061.1-768s1c1
Sequence:CCGGGCCCAAGTCTTGGTATGCTATCTCGAGATAGCATACCAAGACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-246s1c1
Sequence:CCGGCCTTGCATACATGGAGTCTAACTCGAGTTAGACTCCATGTATGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-541s1c1
Sequence:CCGGGCACCTATCTATGGTGCAGATCTCGAGATCTGCACCATAGATAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015061.1-1702s1c1
Sequence:CCGGGCAGAGAGTAATGGTGTGTTACTCGAGTAACACACCATTACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-3151s1c1
Sequence:CCGGGCCTCTGACATGCGATTTGAACTCGAGTTCAAATCGCATGTCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015061
VALIDATED
KDM4C MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015061.2-4140s21c1
Sequence:CCGGCAGCGGGTAGGGCGATAATTTCTCGAGAAATTATCGCCCTACCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-2045s21c1
Sequence:CCGGGCTATGAGAAGCCCGAGAAATCTCGAGATTTCTCGGGCTTCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-3232s21c1
Sequence:CCGGCATCGGAACACCCGGTATTACCTCGAGGTAATACCGGGTGTTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-3141s21c1
Sequence:CCGGCATTACATGCTTTCGACATAACTCGAGTTATGTCGAAAGCATGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-903s21c1
Sequence:CCGGATACTTGGATTACGAAGATTTCTCGAGAAATCTTCGTAATCCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015061.1-768s1c1
Sequence:CCGGGCCCAAGTCTTGGTATGCTATCTCGAGATAGCATACCAAGACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-246s1c1
Sequence:CCGGCCTTGCATACATGGAGTCTAACTCGAGTTAGACTCCATGTATGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-541s1c1
Sequence:CCGGGCACCTATCTATGGTGCAGATCTCGAGATCTGCACCATAGATAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015061.1-1702s1c1
Sequence:CCGGGCAGAGAGTAATGGTGTGTTACTCGAGTAACACACCATTACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-3151s1c1
Sequence:CCGGGCCTCTGACATGCGATTTGAACTCGAGTTCAAATCGCATGTCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015061
VALIDATED
KDM4C MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015061.2-4140s21c1
Sequence:CCGGCAGCGGGTAGGGCGATAATTTCTCGAGAAATTATCGCCCTACCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-2045s21c1
Sequence:CCGGGCTATGAGAAGCCCGAGAAATCTCGAGATTTCTCGGGCTTCTCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-3232s21c1
Sequence:CCGGCATCGGAACACCCGGTATTACCTCGAGGTAATACCGGGTGTTCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-3141s21c1
Sequence:CCGGCATTACATGCTTTCGACATAACTCGAGTTATGTCGAAAGCATGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015061.2-903s21c1
Sequence:CCGGATACTTGGATTACGAAGATTTCTCGAGAAATCTTCGTAATCCAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_015061.1-768s1c1
Sequence:CCGGGCCCAAGTCTTGGTATGCTATCTCGAGATAGCATACCAAGACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-246s1c1
Sequence:CCGGCCTTGCATACATGGAGTCTAACTCGAGTTAGACTCCATGTATGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-541s1c1
Sequence:CCGGGCACCTATCTATGGTGCAGATCTCGAGATCTGCACCATAGATAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015061.1-1702s1c1
Sequence:CCGGGCAGAGAGTAATGGTGTGTTACTCGAGTAACACACCATTACTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015061.1-3151s1c1
Sequence:CCGGGCCTCTGACATGCGATTTGAACTCGAGTTCAAATCGCATGTCAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks