EMAIL THIS PAGE TO A FRIEND

KDM4E

lysine (K)-specific demethylase 4E

Synonyms: JMJD2E KDM4DL
Species: Human KDM4E(390245)
UniProtKB ID: B2RXH2
Gene ID:
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_372429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_372429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_372429 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228991 MISSION® esiRNA esiRNA targeting human KDM4DL human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_372429
KDM4E MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 4E
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-76s1c1
Sequence:CCGGGCAGATTTCAACACATATGTTCTCGAGAACATATGTGTTGAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-1383s1c1
Sequence:CCGGCCTCAACAGCACTACTAGTAACTCGAGTTACTAGTAGTGCTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-2431s1c1
Sequence:CCGGCCAGGAACAATTCAGGACTTTCTCGAGAAAGTCCTGAATTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-379s1c1
Sequence:CCGGCCCGGTAATCCACCAATTTATCTCGAGATAAATTGGTGGATTACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-2555s1c1
Sequence:CCGGGACCTTTACATCAACTACCATCTCGAGATGGTAGTTGATGTAAAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_372429
KDM4E MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 4E
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-76s1c1
Sequence:CCGGGCAGATTTCAACACATATGTTCTCGAGAACATATGTGTTGAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-1383s1c1
Sequence:CCGGCCTCAACAGCACTACTAGTAACTCGAGTTACTAGTAGTGCTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-2431s1c1
Sequence:CCGGCCAGGAACAATTCAGGACTTTCTCGAGAAAGTCCTGAATTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-379s1c1
Sequence:CCGGCCCGGTAATCCACCAATTTATCTCGAGATAAATTGGTGGATTACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-2555s1c1
Sequence:CCGGGACCTTTACATCAACTACCATCTCGAGATGGTAGTTGATGTAAAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_372429
KDM4E MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 4E
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-76s1c1
Sequence:CCGGGCAGATTTCAACACATATGTTCTCGAGAACATATGTGTTGAAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-1383s1c1
Sequence:CCGGCCTCAACAGCACTACTAGTAACTCGAGTTACTAGTAGTGCTGTTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-2431s1c1
Sequence:CCGGCCAGGAACAATTCAGGACTTTCTCGAGAAAGTCCTGAATTGTTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-379s1c1
Sequence:CCGGCCCGGTAATCCACCAATTTATCTCGAGATAAATTGGTGGATTACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_372429.2-2555s1c1
Sequence:CCGGGACCTTTACATCAACTACCATCTCGAGATGGTAGTTGATGTAAAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks