EMAIL THIS PAGE TO A FRIEND

KDM5A

lysine (K)-specific demethylase 5A

Synonyms: RBBP-2 RBBP2 RBP2
UniProtKB ID: P29375, A8MV76, Q4LE72, Q86XZ1
Gene ID:
Human(5927) Summary: The protein encoded by this gene is a ubiquitously expressed nuclear protein. It binds directly, with several other proteins, to retinoblastoma protein which regulates cell proliferation. This protein also interacts with rhombotin-2 which functions distinctly in erythropoiesis and in T-cell leukemogenesis. Rhombotin-2 is thought to either directly affect the activity of the encoded protein or may indirectly modulate the functions of the retinoblastoma protein by binding to this protein. [provided by RefSeq, Mar 2010]
Mouse(214899) lysine (K)-specific demethylase 5A
Rat(312678) lysine (K)-specific demethylase 5A
Zebrafish(100333310) lysine (K)-specific demethylase 5A
chicken(418148) lysine (K)-specific demethylase 5A
dog(477727) lysine (K)-specific demethylase 5A
domestic cat(101087846) lysine (K)-specific demethylase 5A
Horse(100056935) lysine (K)-specific demethylase 5A
cow(507962) lysine (K)-specific demethylase 5A
domestic guinea pig(100730959) lysine (K)-specific demethylase 5A
naked mole-rat(101697034) lysine (K)-specific demethylase 5A
sheep(101115023) lysine (K)-specific demethylase 5A
Domestic Rabbit(100351408) lysine (K)-specific demethylase 5A
329 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA006201 Anti-KDM5A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4301220 Anti-KDM5A antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
WH0005927M3 Monoclonal Anti-JARID1A antibody produced in mouse clone 1H2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0152 Rabbit anti-JARID1A/RBP2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. dog, gibbon, mouse, guinea pig, primate, Chinese hamster, rat, gorilla, human, horse, rabbit
immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005056 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_489840 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_489840 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_489840 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012051 MISSION® esiRNA esiRNA targeting human JARID1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042603 Rosetta Predictions human pricing
NM_005056 Rosetta Predictions human pricing
XM_232246 Rosetta Predictions rat pricing
XR_005442 Rosetta Predictions rat pricing
XR_009628 Rosetta Predictions rat pricing
XM_359326 Rosetta Predictions mouse pricing
XM_925213 Rosetta Predictions mouse pricing
XM_979596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310778 predicted 1553
2 SASI_Hs02_00310779 predicted 2686
3 SASI_Hs02_00310780 predicted 2991
4 SASI_Hs02_00310781 predicted 620
5 SASI_Hs02_00310782 predicted 3108
6 SASI_Hs02_00310783 predicted 2007
7 SASI_Hs02_00310784 predicted 2039
8 SASI_Hs02_00310785 predicted 1506
9 SASI_Hs02_00310786 predicted 3205
10 SASI_Hs02_00310787 predicted 5485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176090 predicted 1556
2 SASI_Hs01_00176091 predicted 2682
3 SASI_Hs01_00176093 predicted 2995
4 SASI_Hs01_00176094 predicted 618
5 SASI_Hs02_00338872 predicted 3103
6 SASI_Hs01_00176095 predicted 2010
7 SASI_Hs02_00338873 predicted 2038
8 SASI_Hs02_00338874 predicted 1503
9 SASI_Hs01_00176098 predicted 3206
10 SASI_Hs02_00338875 predicted 2076
11 SASI_Hs01_00176092 predicted 5284
12 SASI_Hs01_00176096 predicted 5373
13 SASI_Hs01_00176097 predicted 1056
14 SASI_Hs01_00176099 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_232246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136369 predicted 1105
2 SASI_Rn01_00136370 predicted 2010
3 SASI_Rn01_00136371 predicted 1639
4 SASI_Rn01_00136372 predicted 2025
5 SASI_Rn01_00136373 predicted 2654
6 SASI_Rn01_00136374 predicted 2935
7 SASI_Rn01_00136375 predicted 695
8 SASI_Rn01_00136376 predicted 3788
9 SASI_Rn01_00136377 predicted 2535
10 SASI_Rn01_00136378 predicted 862
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409246 predicted 5915
2 SASI_Rn02_00409247 predicted 7905
3 SASI_Rn02_00409248 predicted 5972
4 SASI_Rn02_00409249 predicted 5583
5 SASI_Rn02_00409250 predicted 3205
6 SASI_Rn02_00409251 predicted 7308
7 SASI_Rn02_00409252 predicted 7703
8 SASI_Rn02_00409253 predicted 2789
9 SASI_Rn02_00409254 predicted 2540
10 SASI_Rn02_00409255 predicted 6065
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420453 predicted 5681
2 SASI_Rn02_00420454 predicted 7670
3 SASI_Rn02_00420455 predicted 5736
4 SASI_Rn02_00420456 predicted 5349
5 SASI_Rn02_00420457 predicted 3209
6 SASI_Rn02_00420458 predicted 7075
7 SASI_Rn02_00420459 predicted 236
8 SASI_Rn02_00420460 predicted 7468
9 SASI_Rn02_00420461 predicted 2792
10 SASI_Rn02_00420462 predicted 2535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_359326 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272014 predicted 5104
2 SASI_Mm01_00272016 predicted 2564
3 SASI_Mm01_00272017 predicted 2927
4 SASI_Mm01_00272018 predicted 4346
5 SASI_Mm02_00426322 predicted 3215
6 SASI_Mm01_00272019 predicted 2520
7 SASI_Mm01_00272020 predicted 4257
8 SASI_Mm02_00426323 predicted 2636
9 SASI_Mm01_00272021 predicted 2785
10 SASI_Mm01_00272022 predicted 3448
11 SASI_Mm01_00272015 predicted 5324
12 SASI_Mm01_00272023 predicted 5118
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_925213 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00444502 predicted 7346
2 SASI_Mm02_00444503 predicted 3968
3 SASI_Mm02_00444504 predicted 4722
4 SASI_Mm02_00444505 predicted 5104
5 SASI_Mm02_00444506 predicted 4348
6 SASI_Mm02_00444507 predicted 3921
7 SASI_Mm02_00444508 predicted 5015
8 SASI_Mm02_00444509 predicted 4254
9 SASI_Mm02_00444510 predicted 6662
10 SASI_Mm02_00444511 predicted 3451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447025 predicted 4534
2 SASI_Mm02_00447026 predicted 1151
3 SASI_Mm02_00447027 predicted 1914
4 SASI_Mm02_00447028 predicted 2290
5 SASI_Mm02_00447029 predicted 1257
6 SASI_Mm02_00447030 predicted 1538
7 SASI_Mm02_00447031 predicted 1115
8 SASI_Mm02_00447032 predicted 2207
9 SASI_Mm02_00447033 predicted 1440
10 SASI_Mm02_00447034 predicted 3851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005056
VALIDATED
KDM5A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-3130s1c1
Sequence:CCGGCCTTGAAAGAAGCCTTACAAACTCGAGTTTGTAAGGCTTCTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-3381s1c1
Sequence:CCGGCGGACCGACATTGGTGTATATCTCGAGATATACACCAATGTCGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005056.1-2280s1c1
Sequence:CCGGCCCATGCAGAAGAAATGTCTTCTCGAGAAGACATTTCTTCTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-4071s1c1
Sequence:CCGGCCAGACTTACAGGGACACTTACTCGAGTAAGTGTCCCTGTAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005056.1-5790s1c1
Sequence:CCGGCCAGGTACTTAATGCCCTAAACTCGAGTTTAGGGCATTAAGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-5500s21c1
Sequence:CCGGACTACCAATGGAGGATCTTAACTCGAGTTAAGATCCTCCATTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-1170s21c1
Sequence:CCGGCAACAGGTCAGACGCATTTAACTCGAGTTAAATGCGTCTGACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-4282s21c1
Sequence:CCGGCCAGACTTACAGGGACACTTACTCGAGTAAGTGTCCCTGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005056.2-3592s21c1
Sequence:CCGGCGGACCGACATTGGTGTATATCTCGAGATATACACCAATGTCGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005056.2-3341s21c1
Sequence:CCGGCCTTGAAAGAAGCCTTACAAACTCGAGTTTGTAAGGCTTCTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005056
VALIDATED
KDM5A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-3130s1c1
Sequence:CCGGCCTTGAAAGAAGCCTTACAAACTCGAGTTTGTAAGGCTTCTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-3381s1c1
Sequence:CCGGCGGACCGACATTGGTGTATATCTCGAGATATACACCAATGTCGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005056.1-2280s1c1
Sequence:CCGGCCCATGCAGAAGAAATGTCTTCTCGAGAAGACATTTCTTCTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-4071s1c1
Sequence:CCGGCCAGACTTACAGGGACACTTACTCGAGTAAGTGTCCCTGTAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005056.1-5790s1c1
Sequence:CCGGCCAGGTACTTAATGCCCTAAACTCGAGTTTAGGGCATTAAGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-5500s21c1
Sequence:CCGGACTACCAATGGAGGATCTTAACTCGAGTTAAGATCCTCCATTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-1170s21c1
Sequence:CCGGCAACAGGTCAGACGCATTTAACTCGAGTTAAATGCGTCTGACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-4282s21c1
Sequence:CCGGCCAGACTTACAGGGACACTTACTCGAGTAAGTGTCCCTGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005056.2-3592s21c1
Sequence:CCGGCGGACCGACATTGGTGTATATCTCGAGATATACACCAATGTCGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005056.2-3341s21c1
Sequence:CCGGCCTTGAAAGAAGCCTTACAAACTCGAGTTTGTAAGGCTTCTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005056
VALIDATED
KDM5A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-3130s1c1
Sequence:CCGGCCTTGAAAGAAGCCTTACAAACTCGAGTTTGTAAGGCTTCTTTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-3381s1c1
Sequence:CCGGCGGACCGACATTGGTGTATATCTCGAGATATACACCAATGTCGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005056.1-2280s1c1
Sequence:CCGGCCCATGCAGAAGAAATGTCTTCTCGAGAAGACATTTCTTCTGCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005056.1-4071s1c1
Sequence:CCGGCCAGACTTACAGGGACACTTACTCGAGTAAGTGTCCCTGTAAGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005056.1-5790s1c1
Sequence:CCGGCCAGGTACTTAATGCCCTAAACTCGAGTTTAGGGCATTAAGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329939    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-5500s21c1
Sequence:CCGGACTACCAATGGAGGATCTTAACTCGAGTTAAGATCCTCCATTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-1170s21c1
Sequence:CCGGCAACAGGTCAGACGCATTTAACTCGAGTTAAATGCGTCTGACCTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005056.2-4282s21c1
Sequence:CCGGCCAGACTTACAGGGACACTTACTCGAGTAAGTGTCCCTGTAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005056.2-3592s21c1
Sequence:CCGGCGGACCGACATTGGTGTATATCTCGAGATATACACCAATGTCGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005056.2-3341s21c1
Sequence:CCGGCCTTGAAAGAAGCCTTACAAACTCGAGTTTGTAAGGCTTCTTTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_489840
KDM5A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-2683s1c1
Sequence:CCGGCCTTTGAGTGACTTAGAGGAACTCGAGTTCCTCTAAGTCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-1219s1c1
Sequence:CCGGCAGGGATACAACTTTGCCGAACTCGAGTTCGGCAAAGTTGTATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-445s1c1
Sequence:CCGGCGAGGAAATAATGAGGATAAACTCGAGTTTATCCTCATTATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-4278s1c1
Sequence:CCGGTGTTGGTGTATCCGCAGAAATCTCGAGATTTCTGCGGATACACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-188s1c1
Sequence:CCGGCAAAGAGAACAAGACGAGTTACTCGAGTAACTCGTCTTGTTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_489840
KDM5A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-2683s1c1
Sequence:CCGGCCTTTGAGTGACTTAGAGGAACTCGAGTTCCTCTAAGTCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-1219s1c1
Sequence:CCGGCAGGGATACAACTTTGCCGAACTCGAGTTCGGCAAAGTTGTATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-445s1c1
Sequence:CCGGCGAGGAAATAATGAGGATAAACTCGAGTTTATCCTCATTATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-4278s1c1
Sequence:CCGGTGTTGGTGTATCCGCAGAAATCTCGAGATTTCTGCGGATACACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-188s1c1
Sequence:CCGGCAAAGAGAACAAGACGAGTTACTCGAGTAACTCGTCTTGTTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_489840
KDM5A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-2683s1c1
Sequence:CCGGCCTTTGAGTGACTTAGAGGAACTCGAGTTCCTCTAAGTCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-1219s1c1
Sequence:CCGGCAGGGATACAACTTTGCCGAACTCGAGTTCGGCAAAGTTGTATCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-445s1c1
Sequence:CCGGCGAGGAAATAATGAGGATAAACTCGAGTTTATCCTCATTATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-4278s1c1
Sequence:CCGGTGTTGGTGTATCCGCAGAAATCTCGAGATTTCTGCGGATACACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_489840.1-188s1c1
Sequence:CCGGCAAAGAGAACAAGACGAGTTACTCGAGTAACTCGTCTTGTTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145997
KDM5A MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000326193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-3840s21c1
Sequence:CCGGCCTTTGAGTGACTTAGAGGAACTCGAGTTCCTCTAAGTCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-1416s21c1
Sequence:CCGGCGAGGAAATAATGAGGATAAACTCGAGTTTATCCTCATTATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-1159s21c1
Sequence:CCGGCAAAGAGAACAAGACGAGTTACTCGAGTAACTCGTCTTGTTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-5435s21c1
Sequence:CCGGTGTTGGTGTATCCGCAGAAATCTCGAGATTTCTGCGGATACACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145997
KDM5A MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000326193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-3840s21c1
Sequence:CCGGCCTTTGAGTGACTTAGAGGAACTCGAGTTCCTCTAAGTCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-1416s21c1
Sequence:CCGGCGAGGAAATAATGAGGATAAACTCGAGTTTATCCTCATTATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-1159s21c1
Sequence:CCGGCAAAGAGAACAAGACGAGTTACTCGAGTAACTCGTCTTGTTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-5435s21c1
Sequence:CCGGTGTTGGTGTATCCGCAGAAATCTCGAGATTTCTGCGGATACACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145997
KDM5A MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000326193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-3840s21c1
Sequence:CCGGCCTTTGAGTGACTTAGAGGAACTCGAGTTCCTCTAAGTCACTCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-1416s21c1
Sequence:CCGGCGAGGAAATAATGAGGATAAACTCGAGTTTATCCTCATTATTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-1159s21c1
Sequence:CCGGCAAAGAGAACAAGACGAGTTACTCGAGTAACTCGTCTTGTTCTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145997.2-5435s21c1
Sequence:CCGGTGTTGGTGTATCCGCAGAAATCTCGAGATTTCTGCGGATACACCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks