EMAIL THIS PAGE TO A FRIEND

KDM5D

lysine (K)-specific demethylase 5D

Synonyms: HY HYA JARID1D SMCY
Gene ID:
Human(8284) Summary: This gene encodes a protein containing zinc finger domains. A short peptide derived from this protein is a minor histocompatibility antigen which can lead to graft rejection of male donor cells in a female recipient. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Mouse(20592) lysine (K)-specific demethylase 5D
Rat(100312983) lysine (K)-specific demethylase 5D
dog(100134936) lysine (K)-specific demethylase 5D
Horse(100034191) lysine (K)-specific demethylase 5D
cow(281491) lysine (K)-specific demethylase 5D
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004653 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011419 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011419 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011419 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004653 Rosetta Predictions human pricing
NM_011419 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024807 predicted 2045
2 SASI_Hs02_00338064 predicted 1361
3 SASI_Hs01_00024809 predicted 469
4 SASI_Hs01_00024810 predicted 3239
5 SASI_Hs01_00024811 predicted 1044
6 SASI_Hs01_00024812 predicted 3321
7 SASI_Hs01_00024813 predicted 631
8 SASI_Hs01_00024814 predicted 775
9 SASI_Hs02_00338065 predicted 822
10 SASI_Hs01_00024815 predicted 1178
11 SASI_Hs01_00024808 predicted 2172
12 SASI_Hs01_00024816 predicted 750
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011419 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124449 predicted 3931
2 SASI_Mm01_00124450 predicted 3638
3 SASI_Mm01_00124451 predicted 1675
4 SASI_Mm01_00124453 predicted 594
5 SASI_Mm01_00124454 predicted 1267
6 SASI_Mm01_00124455 predicted 2675
7 SASI_Mm02_00320638 predicted 1883
8 SASI_Mm01_00124456 predicted 2612
9 SASI_Mm01_00124457 predicted 3233
10 SASI_Mm01_00124458 predicted 364
11 SASI_Mm01_00124452 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004653
VALIDATED
KDM5D MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5D
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-524s21c1
Sequence:CCGGCTAGAGTGAAATTGAACTATTCTCGAGAATAGTTCAATTTCACTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-4909s21c1
Sequence:CCGGAGTGGCACCAAAGGTCATTTGCTCGAGCAAATGACCTTTGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.3-4258s21c1
Sequence:CCGGGAGAAGGCAGTGGCAACAATACTCGAGTATTGTTGCCACTGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-3247s21c1
Sequence:CCGGCCACATTGGAAGCCATAATTCCTCGAGGAATTATGGCTTCCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-1368s21c1
Sequence:CCGGTGTATCTTGGCGGAGTGTAAACTCGAGTTTACACTCCGCCAAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.3-1214s21c1
Sequence:CCGGCCAGTTTATTGACTCATATATCTCGAGATATATGAGTCAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-751s21c1
Sequence:CCGGTCACATTACGAACGCATTATTCTCGAGAATAATGCGTTCGTAATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-4718s21c1
Sequence:CCGGGCCGAGAAGAAGAACATTATCCTCGAGGATAATGTTCTTCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-1123s21c1
Sequence:CCGGGGGAACGTGTCATCAACATTGCTCGAGCAATGTTGATGACACGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004653.4-5120s21c1
Sequence:CCGGGCTAGCATACAGGAGTGATTTCTCGAGAAATCACTCCTGTATGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-455s21c1
Sequence:CCGGTTGCAGTAGAAGTTGACAATTCTCGAGAATTGTCAACTTCTACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-487s21c1
Sequence:CCGGCCTCGCGTCCAAAGGCTAAATCTCGAGATTTAGCCTTTGGACGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-619s21c1
Sequence:CCGGGACCTCTACAGCCTTAGTAAGCTCGAGCTTACTAAGGCTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004653.2-747s1c1
Sequence:CCGGCGATCACATTACGAACGCATTCTCGAGAATGCGTTCGTAATGTGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-3246s1c1
Sequence:CCGGGCCACATTGGAAGCCATAATTCTCGAGAATTATGGCTTCCAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-1695s1c1
Sequence:CCGGCCAGTGCTAGATCAGTCTGTTCTCGAGAACAGACTGATCTAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-4787s1c1
Sequence:CCGGCAGCCCTTTCTTGAAAGGAAACTCGAGTTTCCTTTCAAGAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004653.2-489s1c1
Sequence:CCGGCGCGTCCAAAGGCTAAATGAACTCGAGTTCATTTAGCCTTTGGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004653
VALIDATED
KDM5D MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5D
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-524s21c1
Sequence:CCGGCTAGAGTGAAATTGAACTATTCTCGAGAATAGTTCAATTTCACTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-4909s21c1
Sequence:CCGGAGTGGCACCAAAGGTCATTTGCTCGAGCAAATGACCTTTGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.3-4258s21c1
Sequence:CCGGGAGAAGGCAGTGGCAACAATACTCGAGTATTGTTGCCACTGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-3247s21c1
Sequence:CCGGCCACATTGGAAGCCATAATTCCTCGAGGAATTATGGCTTCCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-1368s21c1
Sequence:CCGGTGTATCTTGGCGGAGTGTAAACTCGAGTTTACACTCCGCCAAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.3-1214s21c1
Sequence:CCGGCCAGTTTATTGACTCATATATCTCGAGATATATGAGTCAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-751s21c1
Sequence:CCGGTCACATTACGAACGCATTATTCTCGAGAATAATGCGTTCGTAATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-4718s21c1
Sequence:CCGGGCCGAGAAGAAGAACATTATCCTCGAGGATAATGTTCTTCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-1123s21c1
Sequence:CCGGGGGAACGTGTCATCAACATTGCTCGAGCAATGTTGATGACACGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004653.4-5120s21c1
Sequence:CCGGGCTAGCATACAGGAGTGATTTCTCGAGAAATCACTCCTGTATGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-455s21c1
Sequence:CCGGTTGCAGTAGAAGTTGACAATTCTCGAGAATTGTCAACTTCTACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-487s21c1
Sequence:CCGGCCTCGCGTCCAAAGGCTAAATCTCGAGATTTAGCCTTTGGACGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-619s21c1
Sequence:CCGGGACCTCTACAGCCTTAGTAAGCTCGAGCTTACTAAGGCTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004653.2-747s1c1
Sequence:CCGGCGATCACATTACGAACGCATTCTCGAGAATGCGTTCGTAATGTGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-3246s1c1
Sequence:CCGGGCCACATTGGAAGCCATAATTCTCGAGAATTATGGCTTCCAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-1695s1c1
Sequence:CCGGCCAGTGCTAGATCAGTCTGTTCTCGAGAACAGACTGATCTAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-4787s1c1
Sequence:CCGGCAGCCCTTTCTTGAAAGGAAACTCGAGTTTCCTTTCAAGAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004653.2-489s1c1
Sequence:CCGGCGCGTCCAAAGGCTAAATGAACTCGAGTTCATTTAGCCTTTGGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004653
VALIDATED
KDM5D MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5D
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359186    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-524s21c1
Sequence:CCGGCTAGAGTGAAATTGAACTATTCTCGAGAATAGTTCAATTTCACTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-4909s21c1
Sequence:CCGGAGTGGCACCAAAGGTCATTTGCTCGAGCAAATGACCTTTGGTGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.3-4258s21c1
Sequence:CCGGGAGAAGGCAGTGGCAACAATACTCGAGTATTGTTGCCACTGCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-3247s21c1
Sequence:CCGGCCACATTGGAAGCCATAATTCCTCGAGGAATTATGGCTTCCAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004653.3-1368s21c1
Sequence:CCGGTGTATCTTGGCGGAGTGTAAACTCGAGTTTACACTCCGCCAAGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.3-1214s21c1
Sequence:CCGGCCAGTTTATTGACTCATATATCTCGAGATATATGAGTCAATAAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-751s21c1
Sequence:CCGGTCACATTACGAACGCATTATTCTCGAGAATAATGCGTTCGTAATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-4718s21c1
Sequence:CCGGGCCGAGAAGAAGAACATTATCCTCGAGGATAATGTTCTTCTTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-1123s21c1
Sequence:CCGGGGGAACGTGTCATCAACATTGCTCGAGCAATGTTGATGACACGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359115    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004653.4-5120s21c1
Sequence:CCGGGCTAGCATACAGGAGTGATTTCTCGAGAAATCACTCCTGTATGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-455s21c1
Sequence:CCGGTTGCAGTAGAAGTTGACAATTCTCGAGAATTGTCAACTTCTACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-487s21c1
Sequence:CCGGCCTCGCGTCCAAAGGCTAAATCTCGAGATTTAGCCTTTGGACGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004653.4-619s21c1
Sequence:CCGGGACCTCTACAGCCTTAGTAAGCTCGAGCTTACTAAGGCTGTAGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004653.2-747s1c1
Sequence:CCGGCGATCACATTACGAACGCATTCTCGAGAATGCGTTCGTAATGTGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-3246s1c1
Sequence:CCGGGCCACATTGGAAGCCATAATTCTCGAGAATTATGGCTTCCAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-1695s1c1
Sequence:CCGGCCAGTGCTAGATCAGTCTGTTCTCGAGAACAGACTGATCTAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004653.2-4787s1c1
Sequence:CCGGCAGCCCTTTCTTGAAAGGAAACTCGAGTTTCCTTTCAAGAAAGGGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004653.2-489s1c1
Sequence:CCGGCGCGTCCAAAGGCTAAATGAACTCGAGTTCATTTAGCCTTTGGACGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011419
KDM5D MISSION shRNA Bacterial Glycerol Stock
lysine (K)-specific demethylase 5D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011419.2-5087s1c1
Sequence:CCGGCCTAAGAAGTATTCCCTGTATCTCGAGATACAGGGAATACTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-1799s1c1
Sequence:CCGGGCAGAACACTTAGAGGATGTACTCGAGTACATCCTCTAAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-4784s1c1
Sequence:CCGGCCTTTACTACACCTATCTTATCTCGAGATAAGATAGGTGTAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-2333s1c1
Sequence:CCGGGCCTGTTATGACTGTCCAGATCTCGAGATCTGGACAGTCATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-700s1c1
Sequence:CCGGGCAATGTAACACAGATCCATTCTCGAGAATGGATCTGTGTTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011419
KDM5D MISSION shRNA shRNA Plasmid DNA
lysine (K)-specific demethylase 5D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011419.2-5087s1c1
Sequence:CCGGCCTAAGAAGTATTCCCTGTATCTCGAGATACAGGGAATACTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-1799s1c1
Sequence:CCGGGCAGAACACTTAGAGGATGTACTCGAGTACATCCTCTAAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-4784s1c1
Sequence:CCGGCCTTTACTACACCTATCTTATCTCGAGATAAGATAGGTGTAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-2333s1c1
Sequence:CCGGGCCTGTTATGACTGTCCAGATCTCGAGATCTGGACAGTCATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-700s1c1
Sequence:CCGGGCAATGTAACACAGATCCATTCTCGAGAATGGATCTGTGTTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011419
KDM5D MISSION shRNA Lentiviral Transduction Particles
lysine (K)-specific demethylase 5D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011419.2-5087s1c1
Sequence:CCGGCCTAAGAAGTATTCCCTGTATCTCGAGATACAGGGAATACTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-1799s1c1
Sequence:CCGGGCAGAACACTTAGAGGATGTACTCGAGTACATCCTCTAAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-4784s1c1
Sequence:CCGGCCTTTACTACACCTATCTTATCTCGAGATAAGATAGGTGTAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-2333s1c1
Sequence:CCGGGCCTGTTATGACTGTCCAGATCTCGAGATCTGGACAGTCATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011419.2-700s1c1
Sequence:CCGGGCAATGTAACACAGATCCATTCTCGAGAATGGATCTGTGTTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks