EMAIL THIS PAGE TO A FRIEND

KIAA0195

KIAA0195

Synonyms: TMEM94
UniProtKB ID: Q12767, O75536, Q86XF1
Gene ID:
chicken(422124) KIAA0195
dog(483313) KIAA0195 ortholog
domestic cat(101094464) KIAA0195 ortholog
cow(512110) KIAA0195 ortholog
domestic guinea pig(100715924) KIAA0195 ortholog
naked mole-rat(101719444) KIAA0195 ortholog
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014738 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155741 MISSION® esiRNA esiRNA human KIAA0195 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014738 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122848 predicted 4415
2 SASI_Hs01_00122849 predicted 2899
3 SASI_Hs01_00122851 predicted 1401
4 SASI_Hs01_00122852 predicted 4322
5 SASI_Hs01_00122853 predicted 4239
6 SASI_Hs01_00122854 predicted 3490
7 SASI_Hs01_00122855 predicted 376
8 SASI_Hs01_00122856 predicted 4237
9 SASI_Hs02_00346189 predicted 584
10 SASI_Hs02_00346190 predicted 2094
11 SASI_Hs01_00122850 predicted 1996
12 SASI_Hs01_00122857 predicted 4277
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014738
KIAA0195 MISSION shRNA Bacterial Glycerol Stock
KIAA0195
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1364s21c1
Sequence:CCGGGGATACTCTCAGCAGCTATACCTCGAGGTATAGCTGCTGAGAGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1897s21c1
Sequence:CCAGCCTACGAAGCAGAGGACTTTGCTCGAGCAAAGTCCTCTGCTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-3219s21c1
Sequence:CCGGACCATGTGTGAGATGATAAAGCTCGAGCTTTATCATCTCACACATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1105s21c1
Sequence:CCGGAGTCGGTGATGCTACACTATGCTCGAGCATAGTGTAGCATCACCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-547s1c1
Sequence:CCGGGCGAGGGATCATTGACCAAATCTCGAGATTTGGTCAATGATCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-3889s1c1
Sequence:CCGGGCACACTGTCTTCATTTCCATCTCGAGATGGAAATGAAGACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-1655s1c1
Sequence:CCGGGAGCCCTATTCACACCACAAACTCGAGTTTGTGGTGTGAATAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-2710s1c1
Sequence:CCGGCCGCTTTGTCTACTTCTCTTTCTCGAGAAAGAGAAGTAGACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-706s1c1
Sequence:CCGGGCTGGTTGAAGGAGACATCATCTCGAGATGATGTCTCCTTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014738
KIAA0195 MISSION shRNA shRNA Plasmid DNA
KIAA0195
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1364s21c1
Sequence:CCGGGGATACTCTCAGCAGCTATACCTCGAGGTATAGCTGCTGAGAGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1897s21c1
Sequence:CCAGCCTACGAAGCAGAGGACTTTGCTCGAGCAAAGTCCTCTGCTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-3219s21c1
Sequence:CCGGACCATGTGTGAGATGATAAAGCTCGAGCTTTATCATCTCACACATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1105s21c1
Sequence:CCGGAGTCGGTGATGCTACACTATGCTCGAGCATAGTGTAGCATCACCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-547s1c1
Sequence:CCGGGCGAGGGATCATTGACCAAATCTCGAGATTTGGTCAATGATCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-3889s1c1
Sequence:CCGGGCACACTGTCTTCATTTCCATCTCGAGATGGAAATGAAGACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-1655s1c1
Sequence:CCGGGAGCCCTATTCACACCACAAACTCGAGTTTGTGGTGTGAATAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-2710s1c1
Sequence:CCGGCCGCTTTGTCTACTTCTCTTTCTCGAGAAAGAGAAGTAGACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-706s1c1
Sequence:CCGGGCTGGTTGAAGGAGACATCATCTCGAGATGATGTCTCCTTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014738
KIAA0195 MISSION shRNA Lentiviral Transduction Particles
KIAA0195
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1364s21c1
Sequence:CCGGGGATACTCTCAGCAGCTATACCTCGAGGTATAGCTGCTGAGAGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1897s21c1
Sequence:CCAGCCTACGAAGCAGAGGACTTTGCTCGAGCAAAGTCCTCTGCTTCGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-3219s21c1
Sequence:CCGGACCATGTGTGAGATGATAAAGCTCGAGCTTTATCATCTCACACATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014738.4-1105s21c1
Sequence:CCGGAGTCGGTGATGCTACACTATGCTCGAGCATAGTGTAGCATCACCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-547s1c1
Sequence:CCGGGCGAGGGATCATTGACCAAATCTCGAGATTTGGTCAATGATCCCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-3889s1c1
Sequence:CCGGGCACACTGTCTTCATTTCCATCTCGAGATGGAAATGAAGACAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-1655s1c1
Sequence:CCGGGAGCCCTATTCACACCACAAACTCGAGTTTGTGGTGTGAATAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-2710s1c1
Sequence:CCGGCCGCTTTGTCTACTTCTCTTTCTCGAGAAAGAGAAGTAGACAAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014738.2-706s1c1
Sequence:CCGGGCTGGTTGAAGGAGACATCATCTCGAGATGATGTCTCCTTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks