EMAIL THIS PAGE TO A FRIEND

KIAA0226L

KIAA0226-like

Synonyms: C13orf18
Gene ID:
domestic guinea pig(100713223) KIAA0226-like ortholog
naked mole-rat(101710769) KIAA0226-like ortholog
sheep(101112829) KIAA0226-like ortholog
chicken(418854) KIAA0226-like ortholog
cow(517231) KIAA0226-like ortholog
domestic cat(101081598) KIAA0226-like ortholog
dog(485452) KIAA0226-like ortholog
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025113 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025113 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116711 predicted 1576
2 SASI_Hs01_00116713 predicted 2640
3 SASI_Hs01_00116715 predicted 1546
4 SASI_Hs01_00116716 predicted 2200
5 SASI_Hs01_00116717 predicted 1310
6 SASI_Hs01_00116718 predicted 1334
7 SASI_Hs02_00357811 predicted 2347
8 SASI_Hs01_00116719 predicted 1623
9 SASI_Hs01_00116720 predicted 1661
10 SASI_Hs02_00357812 predicted 1923
11 SASI_Hs01_00116712 predicted 789
12 SASI_Hs01_00116714 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025113
VALIDATED
KIAA0226L MISSION shRNA Bacterial Glycerol Stock
KIAA0226-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025113.1-1103s1c1
Sequence:CCGGCGTACTTACCATGATGTGAAACTCGAGTTTCACATCATGGTAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-1825s1c1
Sequence:CCGGCTTCCATATCAAGAAGCTGTTCTCGAGAACAGCTTCTTGATATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025113.1-1819s1c1
Sequence:CCGGGCAGCTCTTCCATATCAAGAACTCGAGTTCTTGATATGGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-2243s1c1
Sequence:CCGGGTGTTTAAGCACAGGGCTGATCTCGAGATCAGCCCTGTGCTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-357s1c1
Sequence:CCGGGCCAATTAGACATCAGGCTCACTCGAGTGAGCCTGATGTCTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-1904s1c1
Sequence:CCGGGCCAGAATACGACTGTCATCTCTCGAGAGATGACAGTCGTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025113.1-2254s1c1
Sequence:CCGGCAGGGCTGATAGTTGTGGTTTCTCGAGAAACCACAACTATCAGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-1089s1c1
Sequence:CCGGCAGTGACTGAAACACGTACTTCTCGAGAAGTACGTGTTTCAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025113.1-358s1c1
Sequence:CCGGCCAATTAGACATCAGGCTCATCTCGAGATGAGCCTGATGTCTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-2230s1c1
Sequence:CCGGGAATGCAGATTCTGTGTTTAACTCGAGTTAAACACAGAATCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025113.1-1297s1c1
Sequence:CCGGCTGGATACTGTCAGTAGTTAACTCGAGTTAACTACTGACAGTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025113
VALIDATED
KIAA0226L MISSION shRNA shRNA Plasmid DNA
KIAA0226-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025113.1-1103s1c1
Sequence:CCGGCGTACTTACCATGATGTGAAACTCGAGTTTCACATCATGGTAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-1825s1c1
Sequence:CCGGCTTCCATATCAAGAAGCTGTTCTCGAGAACAGCTTCTTGATATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025113.1-1819s1c1
Sequence:CCGGGCAGCTCTTCCATATCAAGAACTCGAGTTCTTGATATGGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-2243s1c1
Sequence:CCGGGTGTTTAAGCACAGGGCTGATCTCGAGATCAGCCCTGTGCTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-357s1c1
Sequence:CCGGGCCAATTAGACATCAGGCTCACTCGAGTGAGCCTGATGTCTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-1904s1c1
Sequence:CCGGGCCAGAATACGACTGTCATCTCTCGAGAGATGACAGTCGTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025113.1-2254s1c1
Sequence:CCGGCAGGGCTGATAGTTGTGGTTTCTCGAGAAACCACAACTATCAGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-1089s1c1
Sequence:CCGGCAGTGACTGAAACACGTACTTCTCGAGAAGTACGTGTTTCAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025113.1-358s1c1
Sequence:CCGGCCAATTAGACATCAGGCTCATCTCGAGATGAGCCTGATGTCTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-2230s1c1
Sequence:CCGGGAATGCAGATTCTGTGTTTAACTCGAGTTAAACACAGAATCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025113.1-1297s1c1
Sequence:CCGGCTGGATACTGTCAGTAGTTAACTCGAGTTAACTACTGACAGTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025113
VALIDATED
KIAA0226L MISSION shRNA Lentiviral Transduction Particles
KIAA0226-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025113.1-1103s1c1
Sequence:CCGGCGTACTTACCATGATGTGAAACTCGAGTTTCACATCATGGTAAGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-1825s1c1
Sequence:CCGGCTTCCATATCAAGAAGCTGTTCTCGAGAACAGCTTCTTGATATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025113.1-1819s1c1
Sequence:CCGGGCAGCTCTTCCATATCAAGAACTCGAGTTCTTGATATGGAAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-2243s1c1
Sequence:CCGGGTGTTTAAGCACAGGGCTGATCTCGAGATCAGCCCTGTGCTTAAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141877    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-357s1c1
Sequence:CCGGGCCAATTAGACATCAGGCTCACTCGAGTGAGCCTGATGTCTAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-1904s1c1
Sequence:CCGGGCCAGAATACGACTGTCATCTCTCGAGAGATGACAGTCGTATTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025113.1-2254s1c1
Sequence:CCGGCAGGGCTGATAGTTGTGGTTTCTCGAGAAACCACAACTATCAGCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025113.1-1089s1c1
Sequence:CCGGCAGTGACTGAAACACGTACTTCTCGAGAAGTACGTGTTTCAGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025113.1-358s1c1
Sequence:CCGGCCAATTAGACATCAGGCTCATCTCGAGATGAGCCTGATGTCTAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_025113.1-2230s1c1
Sequence:CCGGGAATGCAGATTCTGTGTTTAACTCGAGTTAAACACAGAATCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025113.1-1297s1c1
Sequence:CCGGCTGGATACTGTCAGTAGTTAACTCGAGTTAACTACTGACAGTATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks