EMAIL THIS PAGE TO A FRIEND

KIAA0408

KIAA0408

Synonyms: RP3-403A15.2
UniProtKB ID: Q6ZU52, B3KRE5, E1P573, O43158, Q5TF20, Q7L2M2
Gene ID:
chicken(421714) KIAA0408
cow(100140348) KIAA0408 ortholog
domestic cat(101086564) KIAA0408 ortholog
dog(476289) KIAA0408 ortholog
chicken(101750381) KIAA0408 ortholog
chicken(101666090) KIAA0408 ortholog
domestic guinea pig(100732198) KIAA0408 ortholog
naked mole-rat(101722522) KIAA0408 ortholog
sheep(101122115) KIAA0408 ortholog
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014702 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113631 MISSION® esiRNA esiRNA human KIAA0408 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014702 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072361 predicted 2421
2 SASI_Hs01_00072362 predicted 2389
3 SASI_Hs01_00072363 predicted 1877
4 SASI_Hs01_00072364 predicted 2953
5 SASI_Hs01_00072365 predicted 1784
6 SASI_Hs01_00072366 predicted 1828
7 SASI_Hs01_00072367 predicted 1925
8 SASI_Hs01_00072369 predicted 2402
9 SASI_Hs02_00346113 predicted 2249
10 SASI_Hs02_00346114 predicted 2264
11 SASI_Hs01_00072360 predicted 1961
12 SASI_Hs01_00072368 predicted 2206
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014702
KIAA0408 MISSION shRNA Bacterial Glycerol Stock
KIAA0408
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2654s1c1
Sequence:CCGGGCATTTAGAAATGCTCCAAATCTCGAGATTTGGAGCATTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2640s1c1
Sequence:CCGGGCCACATTAAGTCAGCATTTACTCGAGTAAATGCTGACTTAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014702.3-5390s1c1
Sequence:CCGGCCCTAGAATATGCCCTTTATTCTCGAGAATAAAGGGCATATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2369s1c1
Sequence:CCGGGCCTGATAATCCCACCAAGAACTCGAGTTCTTGGTGGGATTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2511s1c1
Sequence:CCGGCCCAGGTCAAATTATGGTGTTCTCGAGAACACCATAATTTGACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014702
KIAA0408 MISSION shRNA shRNA Plasmid DNA
KIAA0408
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2654s1c1
Sequence:CCGGGCATTTAGAAATGCTCCAAATCTCGAGATTTGGAGCATTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2640s1c1
Sequence:CCGGGCCACATTAAGTCAGCATTTACTCGAGTAAATGCTGACTTAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014702.3-5390s1c1
Sequence:CCGGCCCTAGAATATGCCCTTTATTCTCGAGAATAAAGGGCATATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2369s1c1
Sequence:CCGGGCCTGATAATCCCACCAAGAACTCGAGTTCTTGGTGGGATTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2511s1c1
Sequence:CCGGCCCAGGTCAAATTATGGTGTTCTCGAGAACACCATAATTTGACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014702
KIAA0408 MISSION shRNA Lentiviral Transduction Particles
KIAA0408
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167733    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2654s1c1
Sequence:CCGGGCATTTAGAAATGCTCCAAATCTCGAGATTTGGAGCATTTCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2640s1c1
Sequence:CCGGGCCACATTAAGTCAGCATTTACTCGAGTAAATGCTGACTTAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167203    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014702.3-5390s1c1
Sequence:CCGGCCCTAGAATATGCCCTTTATTCTCGAGAATAAAGGGCATATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2369s1c1
Sequence:CCGGGCCTGATAATCCCACCAAGAACTCGAGTTCTTGGTGGGATTATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014702.3-2511s1c1
Sequence:CCGGCCCAGGTCAAATTATGGTGTTCTCGAGAACACCATAATTTGACCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks