EMAIL THIS PAGE TO A FRIEND

KIAA0922

KIAA0922

Synonyms: TMEM131L
Gene ID:
chicken(422400) KIAA0922
dog(482656) KIAA0922 ortholog
cow(505156) KIAA0922 ortholog
domestic cat(101094342) KIAA0922 ortholog
domestic guinea pig(100716397) KIAA0922 ortholog
naked mole-rat(101724309) KIAA0922 ortholog
sheep(101122892) KIAA0922 ortholog
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015196 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015196 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015196 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069611 MISSION® esiRNA esiRNA human KIAA0922 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015196 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015196 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347265 predicted 3600
2 SASI_Hs01_00224454 predicted 2842
3 SASI_Hs01_00224455 predicted 980
4 SASI_Hs01_00224456 predicted 2716
5 SASI_Hs01_00224457 predicted 1566
6 SASI_Hs02_00347266 predicted 2312
7 SASI_Hs01_00224458 predicted 2413
8 SASI_Hs01_00224459 predicted 2470
9 SASI_Hs01_00224460 predicted 3263
10 SASI_Hs01_00224462 predicted 3941
11 SASI_Hs01_00224453 predicted 724
12 SASI_Hs01_00224461 predicted 888
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015196
KIAA0922 MISSION shRNA Bacterial Glycerol Stock
KIAA0922
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-3041s1c1
Sequence:CCGGCCTGCTGCTAAAGAGGACATTCTCGAGAATGTCCTCTTTAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-3554s1c1
Sequence:CCGGCCTTTCGTAGAGCAAGAAGATCTCGAGATCTTCTTGCTCTACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-2796s1c1
Sequence:CCGGGCAAGAACTTTCTCGATACATCTCGAGATGTATCGAGAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-4312s1c1
Sequence:CCGGCCCGGTTCATAATAGTTTCATCTCGAGATGAAACTATTATGAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015196.2-2119s1c1
Sequence:CCGGCCGGAATAACTTGACTGTTATCTCGAGATAACAGTCAAGTTATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-3854s21c1
Sequence:CCGGTGTAAAGCAGATGCCGAAATTCTCGAGAATTTCGGCATCTGCTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-2260s21c1
Sequence:CCGGAGGAGGCTCACTCCGATTTAACTCGAGTTAAATCGGAGTGAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-470s21c1
Sequence:CCGGCCAGTTCCCTGCAGGGTAATTCTCGAGAATTACCCTGCAGGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-4164s21c1
Sequence:CCGGGCAATCCCATGACCGTGAATACTCGAGTATTCACGGTCATGGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015196
KIAA0922 MISSION shRNA shRNA Plasmid DNA
KIAA0922
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-3041s1c1
Sequence:CCGGCCTGCTGCTAAAGAGGACATTCTCGAGAATGTCCTCTTTAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-3554s1c1
Sequence:CCGGCCTTTCGTAGAGCAAGAAGATCTCGAGATCTTCTTGCTCTACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-2796s1c1
Sequence:CCGGGCAAGAACTTTCTCGATACATCTCGAGATGTATCGAGAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-4312s1c1
Sequence:CCGGCCCGGTTCATAATAGTTTCATCTCGAGATGAAACTATTATGAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015196.2-2119s1c1
Sequence:CCGGCCGGAATAACTTGACTGTTATCTCGAGATAACAGTCAAGTTATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-3854s21c1
Sequence:CCGGTGTAAAGCAGATGCCGAAATTCTCGAGAATTTCGGCATCTGCTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-2260s21c1
Sequence:CCGGAGGAGGCTCACTCCGATTTAACTCGAGTTAAATCGGAGTGAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-470s21c1
Sequence:CCGGCCAGTTCCCTGCAGGGTAATTCTCGAGAATTACCCTGCAGGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-4164s21c1
Sequence:CCGGGCAATCCCATGACCGTGAATACTCGAGTATTCACGGTCATGGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015196
KIAA0922 MISSION shRNA Lentiviral Transduction Particles
KIAA0922
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-3041s1c1
Sequence:CCGGCCTGCTGCTAAAGAGGACATTCTCGAGAATGTCCTCTTTAGCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-3554s1c1
Sequence:CCGGCCTTTCGTAGAGCAAGAAGATCTCGAGATCTTCTTGCTCTACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-2796s1c1
Sequence:CCGGGCAAGAACTTTCTCGATACATCTCGAGATGTATCGAGAAAGTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015196.2-4312s1c1
Sequence:CCGGCCCGGTTCATAATAGTTTCATCTCGAGATGAAACTATTATGAACCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015196.2-2119s1c1
Sequence:CCGGCCGGAATAACTTGACTGTTATCTCGAGATAACAGTCAAGTTATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-3854s21c1
Sequence:CCGGTGTAAAGCAGATGCCGAAATTCTCGAGAATTTCGGCATCTGCTTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-2260s21c1
Sequence:CCGGAGGAGGCTCACTCCGATTTAACTCGAGTTAAATCGGAGTGAGCCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-470s21c1
Sequence:CCGGCCAGTTCCCTGCAGGGTAATTCTCGAGAATTACCCTGCAGGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015196.3-4164s21c1
Sequence:CCGGGCAATCCCATGACCGTGAATACTCGAGTATTCACGGTCATGGGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks