EMAIL THIS PAGE TO A FRIEND

KIAA1107

KIAA1107

UniProtKB ID: Q9UPP5, O14767, Q8N3X7
Gene ID:
domestic guinea pig(101787797) KIAA1107 ortholog
naked mole-rat(101718627) KIAA1107 ortholog
sheep(101103197) KIAA1107 ortholog
chicken(424504) KIAA1107
dog(479953) KIAA1107 ortholog
domestic cat(101086076) KIAA1107 ortholog
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015237 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143561 MISSION® esiRNA esiRNA human KIAA1107 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_034086 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_034086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281250 predicted 292
2 SASI_Hs01_00281251 predicted 2369
3 SASI_Hs01_00281252 predicted 2117
4 SASI_Hs01_00281253 predicted 2472
5 SASI_Hs01_00281254 predicted 2652
6 SASI_Hs01_00281255 predicted 2628
7 SASI_Hs01_00281256 predicted 376
8 SASI_Hs01_00281257 predicted 1205
9 SASI_Hs01_00281258 predicted 3814
10 SASI_Hs01_00281259 predicted 3952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015237
KIAA1107 MISSION shRNA Bacterial Glycerol Stock
KIAA1107
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-434s21c1
Sequence:CCGGTTCTGACTCTGGTGATATAAACTCGAGTTTATATCACCAGAGTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-829s21c1
Sequence:CCGGGAAATCAGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015237.2-4231s21c1
Sequence:CCGGTAATTGCATTAGCCGGATATACTCGAGTATATCCGGCTAATGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-494s21c1
Sequence:CCGGGAGTTATCTCTCTACTAATAACTCGAGTTATTAGTAGAGAGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-1975s21c1
Sequence:CCGGATTGCGATGCAGCTAACATATCTCGAGATATGTTAGCTGCATCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015237
KIAA1107 MISSION shRNA shRNA Plasmid DNA
KIAA1107
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-434s21c1
Sequence:CCGGTTCTGACTCTGGTGATATAAACTCGAGTTTATATCACCAGAGTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-829s21c1
Sequence:CCGGGAAATCAGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015237.2-4231s21c1
Sequence:CCGGTAATTGCATTAGCCGGATATACTCGAGTATATCCGGCTAATGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-494s21c1
Sequence:CCGGGAGTTATCTCTCTACTAATAACTCGAGTTATTAGTAGAGAGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-1975s21c1
Sequence:CCGGATTGCGATGCAGCTAACATATCTCGAGATATGTTAGCTGCATCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015237
KIAA1107 MISSION shRNA Lentiviral Transduction Particles
KIAA1107
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-434s21c1
Sequence:CCGGTTCTGACTCTGGTGATATAAACTCGAGTTTATATCACCAGAGTCAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-829s21c1
Sequence:CCGGGAAATCAGGAAGGGCAAATTTCTCGAGAAATTTGCCCTTCCTGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015237.2-4231s21c1
Sequence:CCGGTAATTGCATTAGCCGGATATACTCGAGTATATCCGGCTAATGCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-494s21c1
Sequence:CCGGGAGTTATCTCTCTACTAATAACTCGAGTTATTAGTAGAGAGATAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015237.2-1975s21c1
Sequence:CCGGATTGCGATGCAGCTAACATATCTCGAGATATGTTAGCTGCATCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks