EMAIL THIS PAGE TO A FRIEND

KIAA1244

KIAA1244

Synonyms: A7322 ARFGEF3 BIG3 C6orf92 PPP1R33 dJ171N11.1
Gene ID:
sheep(101113941) KIAA1244 ortholog
domestic guinea pig(100719953) KIAA1244 ortholog
naked mole-rat(101705880) KIAA1244 ortholog
chicken(421681) KIAA1244
dog(484007) KIAA1244 ortholog
domestic cat(101087840) KIAA1244 ortholog
cow(522232) KIAA1244 ortholog
113 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA036350 Anti-KIAA1244 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020340 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU048171 MISSION® esiRNA esiRNA human KIAA1244 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020340 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188651 predicted 6584
2 SASI_Hs01_00188652 predicted 570
3 SASI_Hs01_00188653 predicted 6351
4 SASI_Hs01_00188654 predicted 4054
5 SASI_Hs01_00188657 predicted 1256
6 SASI_Hs01_00188658 predicted 4232
7 SASI_Hs02_00353266 predicted 1762
8 SASI_Hs02_00353267 predicted 4542
9 SASI_Hs02_00353268 predicted 583
10 SASI_Hs02_00353269 predicted 5679
11 SASI_Hs01_00188655 predicted 4163
12 SASI_Hs01_00188656 predicted 1571
13 SASI_Hs01_00188659 predicted 4942
14 SASI_Hs01_00188660 predicted 5884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020340
VALIDATED
KIAA1244 MISSION shRNA Bacterial Glycerol Stock
KIAA1244
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020340.4-3942s21c1
Sequence:CCGGCCGACCTTTCGAGCGCATTATCTCGAGATAATGCGCTCGAAAGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020340.4-7057s21c1
Sequence:CCGGGATCCATTTGATCCATCATTTCTCGAGAAATGATGGATCAAATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-4234s1c1
Sequence:CCGGCCAACTCTGGATTTACTCTTTCTCGAGAAAGAGTAAATCCAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-376s1c1
Sequence:CCGGCCACAGGATTTCGGGAATCAACTCGAGTTGATTCCCGAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-8215s1c1
Sequence:CCGGCCTGAGGTTCAGTTCTTCTTTCTCGAGAAAGAAGAACTGAACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020340.2-6832s1c1
Sequence:CCGGGCTGGGAAGAAGACAACTATACTCGAGTATAGTTGTCTTCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020340.2-1923s1c1
Sequence:CCGGCTCTACTTTCTGCTCAGGCATCTCGAGATGCCTGAGCAGAAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020340.2-2695s1c1
Sequence:CCGGGCCATCACACAAGTGAAACTACTCGAGTAGTTTCACTTGTGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020340
VALIDATED
KIAA1244 MISSION shRNA shRNA Plasmid DNA
KIAA1244
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020340.4-3942s21c1
Sequence:CCGGCCGACCTTTCGAGCGCATTATCTCGAGATAATGCGCTCGAAAGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020340.4-7057s21c1
Sequence:CCGGGATCCATTTGATCCATCATTTCTCGAGAAATGATGGATCAAATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-4234s1c1
Sequence:CCGGCCAACTCTGGATTTACTCTTTCTCGAGAAAGAGTAAATCCAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-376s1c1
Sequence:CCGGCCACAGGATTTCGGGAATCAACTCGAGTTGATTCCCGAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-8215s1c1
Sequence:CCGGCCTGAGGTTCAGTTCTTCTTTCTCGAGAAAGAAGAACTGAACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020340.2-6832s1c1
Sequence:CCGGGCTGGGAAGAAGACAACTATACTCGAGTATAGTTGTCTTCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020340.2-1923s1c1
Sequence:CCGGCTCTACTTTCTGCTCAGGCATCTCGAGATGCCTGAGCAGAAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020340.2-2695s1c1
Sequence:CCGGGCCATCACACAAGTGAAACTACTCGAGTAGTTTCACTTGTGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020340
VALIDATED
KIAA1244 MISSION shRNA Lentiviral Transduction Particles
KIAA1244
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020340.4-3942s21c1
Sequence:CCGGCCGACCTTTCGAGCGCATTATCTCGAGATAATGCGCTCGAAAGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020340.4-7057s21c1
Sequence:CCGGGATCCATTTGATCCATCATTTCTCGAGAAATGATGGATCAAATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-4234s1c1
Sequence:CCGGCCAACTCTGGATTTACTCTTTCTCGAGAAAGAGTAAATCCAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-376s1c1
Sequence:CCGGCCACAGGATTTCGGGAATCAACTCGAGTTGATTCCCGAAATCCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020340.2-8215s1c1
Sequence:CCGGCCTGAGGTTCAGTTCTTCTTTCTCGAGAAAGAAGAACTGAACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020340.2-6832s1c1
Sequence:CCGGGCTGGGAAGAAGACAACTATACTCGAGTATAGTTGTCTTCTTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020340.2-1923s1c1
Sequence:CCGGCTCTACTTTCTGCTCAGGCATCTCGAGATGCCTGAGCAGAAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020340.2-2695s1c1
Sequence:CCGGGCCATCACACAAGTGAAACTACTCGAGTAGTTTCACTTGTGTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks