EMAIL THIS PAGE TO A FRIEND

KIAA1324L

KIAA1324-like

Synonyms: EIG121L
UniProtKB ID: A8MWY0, A4D1C9, B4DJV3, Q17RI6, Q96DP2
Gene ID:
domestic guinea pig(100722350) KIAA1324-like ortholog
naked mole-rat(101713406) KIAA1324-like ortholog
sheep(101112642) KIAA1324-like ortholog
chicken(418645) KIAA1324-like
dog(475216) KIAA1324-like ortholog
domestic cat(101096049) KIAA1324-like ortholog
cow(518313) KIAA1324-like ortholog
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152748 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063931 MISSION® esiRNA esiRNA human KIAA1324L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152748 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101355 predicted 728
2 SASI_Hs01_00101356 predicted 1984
3 SASI_Hs01_00101357 predicted 1085
4 SASI_Hs01_00101358 predicted 1623
5 SASI_Hs01_00101359 predicted 1913
6 SASI_Hs01_00101360 predicted 1101
7 SASI_Hs01_00101361 predicted 1818
8 SASI_Hs01_00101362 predicted 2065
9 SASI_Hs01_00101363 predicted 1347
10 SASI_Hs01_00101364 predicted 2289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152748
VALIDATED
KIAA1324L MISSION shRNA Bacterial Glycerol Stock
KIAA1324-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-2764s1c1
Sequence:CCGGCAAAGAAACCTGCTCTAGTTTCTCGAGAAACTAGAGCAGGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-2001s1c1
Sequence:CCGGGAGTCACAGTTGAAACCACATCTCGAGATGTGGTTTCAACTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152748.2-2220s1c1
Sequence:CCGGGTGATGGGTGTACGTTCTATTCTCGAGAATAGAACGTACACCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-2279s1c1
Sequence:CCGGGAGCATGACTTCCATGAGATTCTCGAGAATCTCATGGAAGTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152748.2-2523s1c1
Sequence:CCGGCCAAGTTAGTAATGACGACTACTCGAGTAGTCGTCATTACTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-944s1c1
Sequence:CCGGGCACTTGGCTTTGAATATAAACTCGAGTTTATATTCAAAGCCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-1914s1c1
Sequence:CCGGGCCAGTCAACAATTATTCCTTCTCGAGAAGGAATAATTGTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-1823s1c1
Sequence:CCGGGCTCTCTGTACCAACAATATACTCGAGTATATTGTTGGTACAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-402s1c1
Sequence:CCGGCAAACATACTCTACTGGAGAACTCGAGTTCTCCAGTAGAGTATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152748
VALIDATED
KIAA1324L MISSION shRNA shRNA Plasmid DNA
KIAA1324-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-2764s1c1
Sequence:CCGGCAAAGAAACCTGCTCTAGTTTCTCGAGAAACTAGAGCAGGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-2001s1c1
Sequence:CCGGGAGTCACAGTTGAAACCACATCTCGAGATGTGGTTTCAACTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152748.2-2220s1c1
Sequence:CCGGGTGATGGGTGTACGTTCTATTCTCGAGAATAGAACGTACACCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-2279s1c1
Sequence:CCGGGAGCATGACTTCCATGAGATTCTCGAGAATCTCATGGAAGTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152748.2-2523s1c1
Sequence:CCGGCCAAGTTAGTAATGACGACTACTCGAGTAGTCGTCATTACTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-944s1c1
Sequence:CCGGGCACTTGGCTTTGAATATAAACTCGAGTTTATATTCAAAGCCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-1914s1c1
Sequence:CCGGGCCAGTCAACAATTATTCCTTCTCGAGAAGGAATAATTGTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-1823s1c1
Sequence:CCGGGCTCTCTGTACCAACAATATACTCGAGTATATTGTTGGTACAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-402s1c1
Sequence:CCGGCAAACATACTCTACTGGAGAACTCGAGTTCTCCAGTAGAGTATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152748
VALIDATED
KIAA1324L MISSION shRNA Lentiviral Transduction Particles
KIAA1324-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-2764s1c1
Sequence:CCGGCAAAGAAACCTGCTCTAGTTTCTCGAGAAACTAGAGCAGGTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-2001s1c1
Sequence:CCGGGAGTCACAGTTGAAACCACATCTCGAGATGTGGTTTCAACTGTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_152748.2-2220s1c1
Sequence:CCGGGTGATGGGTGTACGTTCTATTCTCGAGAATAGAACGTACACCCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-2279s1c1
Sequence:CCGGGAGCATGACTTCCATGAGATTCTCGAGAATCTCATGGAAGTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152748.2-2523s1c1
Sequence:CCGGCCAAGTTAGTAATGACGACTACTCGAGTAGTCGTCATTACTAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-944s1c1
Sequence:CCGGGCACTTGGCTTTGAATATAAACTCGAGTTTATATTCAAAGCCAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152748.2-1914s1c1
Sequence:CCGGGCCAGTCAACAATTATTCCTTCTCGAGAAGGAATAATTGTTGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-1823s1c1
Sequence:CCGGGCTCTCTGTACCAACAATATACTCGAGTATATTGTTGGTACAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152748.2-402s1c1
Sequence:CCGGCAAACATACTCTACTGGAGAACTCGAGTTCTCCAGTAGAGTATGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks