EMAIL THIS PAGE TO A FRIEND

KIAA1429

KIAA1429

Synonyms: fSAP121
Gene ID:
domestic guinea pig(100734126) KIAA1429 ortholog
naked mole-rat(101698486) KIAA1429 ortholog
sheep(101110342) KIAA1429 ortholog
chicken(420227) KIAA1429
cow(782848) KIAA1429 ortholog
dog(477942) KIAA1429 ortholog
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA031530 Anti-KIAA1429 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015496 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055891 MISSION® esiRNA esiRNA human KIAA1429 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015496 Rosetta Predictions human pricing
NM_183009 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076502 predicted 2865
2 SASI_Hs01_00076503 predicted 1450
3 SASI_Hs01_00076504 predicted 1108
4 SASI_Hs01_00076506 predicted 1385
5 SASI_Hs02_00347963 predicted 1167
6 SASI_Hs01_00076508 predicted 1248
7 SASI_Hs01_00076509 predicted 3163
8 SASI_Hs01_00076510 predicted 2908
9 SASI_Hs01_00076511 predicted 1158
10 SASI_Hs02_00347964 predicted 1455
11 SASI_Hs01_00076505 predicted 2547
12 SASI_Hs01_00076507 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183009 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158086 predicted 2870
2 SASI_Hs01_00158087 predicted 1453
3 SASI_Hs01_00158088 predicted 1105
4 SASI_Hs01_00158090 predicted 1382
5 SASI_Hs02_00371178 predicted 1168
6 SASI_Hs01_00158092 predicted 1248
7 SASI_Hs01_00158093 predicted 3156
8 SASI_Hs01_00158094 predicted 2907
9 SASI_Hs01_00158095 predicted 1158
10 SASI_Hs02_00371179 predicted 1458
11 SASI_Hs01_00158089 predicted 2538
12 SASI_Hs01_00158091 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015496
KIAA1429 MISSION shRNA Bacterial Glycerol Stock
KIAA1429
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1972s21c1
Sequence:CCGGCCCAACGATGGCACGAATTACCTCGAGGTAATTCGTGCCATCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1453s21c1
Sequence:CCGGAGGAGTGATCAGTGGATTATTCTCGAGAATAATCCACTGATCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-5433s21c1
Sequence:CCGGTACGCTCCTTTACACGATAAACTCGAGTTTATCGTGTAAAGGAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1348s21c1
Sequence:CCGGTCGCCAACCTATCGCCTTAAACTCGAGTTTAAGGCGATAGGTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-70s1c1
Sequence:CCGGCGCTGAGCAAAGTTCTCATATCTCGAGATATGAGAACTTTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-3487s1c1
Sequence:CCGGCCAAGAAATAGTTCGCTCTTTCTCGAGAAAGAGCGAACTATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-4133s1c1
Sequence:CCGGGCTCTGCATAGTTTACTGAAACTCGAGTTTCAGTAAACTATGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-2181s1c1
Sequence:CCGGCGGAATATGAAGCAACAAATTCTCGAGAATTTGTTGCTTCATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015496.3-5623s1c1
Sequence:CCGGCCAAACTTTGTATGTACGTTTCTCGAGAAACGTACATACAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015496
KIAA1429 MISSION shRNA shRNA Plasmid DNA
KIAA1429
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1972s21c1
Sequence:CCGGCCCAACGATGGCACGAATTACCTCGAGGTAATTCGTGCCATCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1453s21c1
Sequence:CCGGAGGAGTGATCAGTGGATTATTCTCGAGAATAATCCACTGATCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-5433s21c1
Sequence:CCGGTACGCTCCTTTACACGATAAACTCGAGTTTATCGTGTAAAGGAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1348s21c1
Sequence:CCGGTCGCCAACCTATCGCCTTAAACTCGAGTTTAAGGCGATAGGTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-70s1c1
Sequence:CCGGCGCTGAGCAAAGTTCTCATATCTCGAGATATGAGAACTTTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-3487s1c1
Sequence:CCGGCCAAGAAATAGTTCGCTCTTTCTCGAGAAAGAGCGAACTATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-4133s1c1
Sequence:CCGGGCTCTGCATAGTTTACTGAAACTCGAGTTTCAGTAAACTATGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-2181s1c1
Sequence:CCGGCGGAATATGAAGCAACAAATTCTCGAGAATTTGTTGCTTCATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015496.3-5623s1c1
Sequence:CCGGCCAAACTTTGTATGTACGTTTCTCGAGAAACGTACATACAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015496
KIAA1429 MISSION shRNA Lentiviral Transduction Particles
KIAA1429
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1972s21c1
Sequence:CCGGCCCAACGATGGCACGAATTACCTCGAGGTAATTCGTGCCATCGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1453s21c1
Sequence:CCGGAGGAGTGATCAGTGGATTATTCTCGAGAATAATCCACTGATCACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-5433s21c1
Sequence:CCGGTACGCTCCTTTACACGATAAACTCGAGTTTATCGTGTAAAGGAGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015496.3-1348s21c1
Sequence:CCGGTCGCCAACCTATCGCCTTAAACTCGAGTTTAAGGCGATAGGTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-70s1c1
Sequence:CCGGCGCTGAGCAAAGTTCTCATATCTCGAGATATGAGAACTTTGCTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-3487s1c1
Sequence:CCGGCCAAGAAATAGTTCGCTCTTTCTCGAGAAAGAGCGAACTATTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-4133s1c1
Sequence:CCGGGCTCTGCATAGTTTACTGAAACTCGAGTTTCAGTAAACTATGCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015496.3-2181s1c1
Sequence:CCGGCGGAATATGAAGCAACAAATTCTCGAGAATTTGTTGCTTCATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074723    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015496.3-5623s1c1
Sequence:CCGGCCAAACTTTGTATGTACGTTTCTCGAGAAACGTACATACAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks