EMAIL THIS PAGE TO A FRIEND

KIAA1462

KIAA1462

Synonyms: JCAD
UniProtKB ID: Q9P266, Q5HYA7, Q5T992, Q86WZ9, Q9BYJ2
Gene ID:
domestic guinea pig(100729721) KIAA1462 ortholog
naked mole-rat(101712113) KIAA1462 ortholog
sheep(101116590) KIAA1462 ortholog
chicken(420476) KIAA1462
dog(477964) KIAA1462 ortholog
domestic cat(101091121) KIAA1462 ortholog
cow(784675) KIAA1462 ortholog
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017956 Anti-KIAA1462 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020848 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049661 MISSION® esiRNA esiRNA human KIAA1462 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020848 Rosetta Predictions human pricing
XM_166132 Rosetta Predictions human pricing
XM_929312 Rosetta Predictions human pricing
XM_933582 Rosetta Predictions human pricing
XM_933586 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354105 predicted 2048
2 SASI_Hs02_00354106 predicted 1837
3 SASI_Hs02_00354107 predicted 1296
4 SASI_Hs02_00354108 predicted 570
5 SASI_Hs02_00354109 predicted 2032
6 SASI_Hs02_00354110 predicted 785
7 SASI_Hs02_00354111 predicted 1827
8 SASI_Hs02_00354112 predicted 2972
9 SASI_Hs02_00354113 predicted 3720
10 SASI_Hs02_00354114 predicted 1707
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166132 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271211 predicted 2207
2 SASI_Hs01_00271212 predicted 2005
3 SASI_Hs01_00271213 predicted 1463
4 SASI_Hs01_00271214 predicted 4077
5 SASI_Hs01_00271215 predicted 740
6 SASI_Hs01_00271216 predicted 2205
7 SASI_Hs01_00271217 predicted 1990
8 SASI_Hs01_00271218 predicted 3133
9 SASI_Hs01_00271219 predicted 3896
10 SASI_Hs01_00271220 predicted 1881
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280752 predicted 2298
2 SASI_Hs01_00280753 predicted 2094
3 SASI_Hs01_00280754 predicted 1551
4 SASI_Hs01_00280755 predicted 4165
5 SASI_Hs01_00280756 predicted 819
6 SASI_Hs01_00280757 predicted 2280
7 SASI_Hs01_00280758 predicted 2078
8 SASI_Hs01_00280759 predicted 3218
9 SASI_Hs01_00280760 predicted 3979
10 SASI_Hs01_00280761 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250964 predicted 2293
2 SASI_Hs01_00250965 predicted 2087
3 SASI_Hs01_00250966 predicted 1552
4 SASI_Hs01_00250967 predicted 4159
5 SASI_Hs01_00250968 predicted 825
6 SASI_Hs01_00250969 predicted 2281
7 SASI_Hs01_00250970 predicted 2074
8 SASI_Hs01_00250971 predicted 3220
9 SASI_Hs01_00250972 predicted 3972
10 SASI_Hs01_00250973 predicted 1963
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933586 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283126 predicted 770
2 SASI_Hs01_00283127 predicted 716
3 SASI_Hs01_00283128 predicted 784
4 SASI_Hs01_00283129 predicted 732
5 SASI_Hs01_00283130 predicted 630
6 SASI_Hs01_00283131 predicted 567
7 SASI_Hs01_00283132 predicted 502
8 SASI_Hs01_00283133 predicted 724
9 SASI_Hs01_00283134 predicted 618
10 SASI_Hs01_00283135 predicted 737
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020848
VALIDATED
KIAA1462 MISSION shRNA Bacterial Glycerol Stock
KIAA1462
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-778s21c1
Sequence:CCGGGCCTGAGTTGCACGGAAATTCCTCGAGGAATTTCCGTGCAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-3687s21c1
Sequence:CCGGCCACCCTTCAGGTCCACTTTACTCGAGTAAAGTGGACCTGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-1394s21c1
Sequence:CCGGCATAAAGCTTGACGATAAATCCTCGAGGATTTATCGTCAAGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-5142s21c1
Sequence:CCGGGACATATCACAGGGTTAATAACTCGAGTTATTAACCCTGTGATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-1340s21c1
Sequence:CCGGTGATCCACGGTTACGACATTTCTCGAGAAATGTCGTAACCGTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020848
VALIDATED
KIAA1462 MISSION shRNA shRNA Plasmid DNA
KIAA1462
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-778s21c1
Sequence:CCGGGCCTGAGTTGCACGGAAATTCCTCGAGGAATTTCCGTGCAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-3687s21c1
Sequence:CCGGCCACCCTTCAGGTCCACTTTACTCGAGTAAAGTGGACCTGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-1394s21c1
Sequence:CCGGCATAAAGCTTGACGATAAATCCTCGAGGATTTATCGTCAAGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-5142s21c1
Sequence:CCGGGACATATCACAGGGTTAATAACTCGAGTTATTAACCCTGTGATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-1340s21c1
Sequence:CCGGTGATCCACGGTTACGACATTTCTCGAGAAATGTCGTAACCGTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020848
VALIDATED
KIAA1462 MISSION shRNA Lentiviral Transduction Particles
KIAA1462
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-778s21c1
Sequence:CCGGGCCTGAGTTGCACGGAAATTCCTCGAGGAATTTCCGTGCAACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-3687s21c1
Sequence:CCGGCCACCCTTCAGGTCCACTTTACTCGAGTAAAGTGGACCTGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-1394s21c1
Sequence:CCGGCATAAAGCTTGACGATAAATCCTCGAGGATTTATCGTCAAGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-5142s21c1
Sequence:CCGGGACATATCACAGGGTTAATAACTCGAGTTATTAACCCTGTGATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_020848.1-1340s21c1
Sequence:CCGGTGATCCACGGTTACGACATTTCTCGAGAAATGTCGTAACCGTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks