EMAIL THIS PAGE TO A FRIEND

KIAA1468

KIAA1468

Synonyms: HsT3308 HsT885
UniProtKB ID: Q9P260
Gene ID:
domestic guinea pig(100724398) KIAA1468 ortholog
naked mole-rat(101698679) KIAA1468 ortholog
sheep(101118578) KIAA1468 ortholog
chicken(420907) KIAA1468
cow(504761) KIAA1468 ortholog
domestic cat(101082854) KIAA1468 ortholog
132 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020854 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132611 MISSION® esiRNA esiRNA human KIAA1468 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020854 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120542 predicted 1947
2 SASI_Hs02_00354116 predicted 955
3 SASI_Hs01_00120543 predicted 3115
4 SASI_Hs01_00120544 predicted 3532
5 SASI_Hs02_00354117 predicted 2575
6 SASI_Hs01_00120545 predicted 1728
7 SASI_Hs01_00120546 predicted 3256
8 SASI_Hs01_00120547 predicted 2555
9 SASI_Hs01_00120550 predicted 2179
10 SASI_Hs01_00120551 predicted 2039
11 SASI_Hs01_00120548 predicted 956
12 SASI_Hs01_00120549 predicted 2606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020854
VALIDATED
KIAA1468 MISSION shRNA Bacterial Glycerol Stock
KIAA1468
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020854.2-3095s1c1
Sequence:CCGGCCAAAGATATTTGCACTGCTTCTCGAGAAGCAGTGCAAATATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020854.2-3096s1c1
Sequence:CCGGCAAAGATATTTGCACTGCTTTCTCGAGAAAGCAGTGCAAATATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-1085s21c1
Sequence:CCGGATGGGATGATGTAGGATTAAACTCGAGTTTAATCCTACATCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-1216s21c1
Sequence:CCGGAGGCCCTTACACCAATTATAACTCGAGTTATAATTGGTGTAAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-2597s21c1
Sequence:CCGGTCAAGATGTGTCCACTATTATCTCGAGATAATAGTGGACACATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020854.3-4207s21c1
Sequence:CCGGAGCTATTACAATGGTACTTAACTCGAGTTAAGTACCATTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-2951s21c1
Sequence:CCGGAGGAGTCCTTACGTGTTATATCTCGAGATATAACACGTAAGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020854
VALIDATED
KIAA1468 MISSION shRNA shRNA Plasmid DNA
KIAA1468
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020854.2-3095s1c1
Sequence:CCGGCCAAAGATATTTGCACTGCTTCTCGAGAAGCAGTGCAAATATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020854.2-3096s1c1
Sequence:CCGGCAAAGATATTTGCACTGCTTTCTCGAGAAAGCAGTGCAAATATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-1085s21c1
Sequence:CCGGATGGGATGATGTAGGATTAAACTCGAGTTTAATCCTACATCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-1216s21c1
Sequence:CCGGAGGCCCTTACACCAATTATAACTCGAGTTATAATTGGTGTAAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-2597s21c1
Sequence:CCGGTCAAGATGTGTCCACTATTATCTCGAGATAATAGTGGACACATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020854.3-4207s21c1
Sequence:CCGGAGCTATTACAATGGTACTTAACTCGAGTTAAGTACCATTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-2951s21c1
Sequence:CCGGAGGAGTCCTTACGTGTTATATCTCGAGATATAACACGTAAGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020854
VALIDATED
KIAA1468 MISSION shRNA Lentiviral Transduction Particles
KIAA1468
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166882    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020854.2-3095s1c1
Sequence:CCGGCCAAAGATATTTGCACTGCTTCTCGAGAAGCAGTGCAAATATCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166849    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020854.2-3096s1c1
Sequence:CCGGCAAAGATATTTGCACTGCTTTCTCGAGAAAGCAGTGCAAATATCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-1085s21c1
Sequence:CCGGATGGGATGATGTAGGATTAAACTCGAGTTTAATCCTACATCATCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-1216s21c1
Sequence:CCGGAGGCCCTTACACCAATTATAACTCGAGTTATAATTGGTGTAAGGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-2597s21c1
Sequence:CCGGTCAAGATGTGTCCACTATTATCTCGAGATAATAGTGGACACATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020854.3-4207s21c1
Sequence:CCGGAGCTATTACAATGGTACTTAACTCGAGTTAAGTACCATTGTAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_020854.3-2951s21c1
Sequence:CCGGAGGAGTCCTTACGTGTTATATCTCGAGATATAACACGTAAGGACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks