EMAIL THIS PAGE TO A FRIEND

KIF12

kinesin family member 12

Synonyms: RP11-56P10.3
UniProtKB ID: Q96FN5, Q5TBE0
Gene ID:
Human(113220) Summary: KIF12 is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that play important roles in intracellular transport and cell division (Nakagawa et al., 1997 [PubMed 9275178]
Mouse(16552) kinesin family member 12
Rat(313254) kinesin family member 12
domestic guinea pig(100714078) kinesin family member 12
naked mole-rat(101725404) kinesin family member 12
sheep(101119620) kinesin family member 12
Domestic Rabbit(100355896) kinesin family member 12
chicken(427829) kinesin family member 12
domestic cat(101082859) kinesin family member 12
cow(510819) kinesin family member 12
Horse(100051706) kinesin family member 12
dog(481686) kinesin family member 12
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138424 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU088331 MISSION® esiRNA esiRNA human KIF12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138424 Rosetta Predictions human pricing
NM_001012102 Rosetta Predictions rat pricing
XM_001058042 Rosetta Predictions rat pricing
XM_575840 Rosetta Predictions rat pricing
NM_010616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242758 predicted 369
2 SASI_Hs01_00242759 predicted 1521
3 SASI_Hs01_00242760 predicted 1512
4 SASI_Hs01_00242761 predicted 789
5 SASI_Hs01_00242762 predicted 960
6 SASI_Hs01_00242763 predicted 525
7 SASI_Hs01_00242764 predicted 467
8 SASI_Hs01_00242765 predicted 292
9 SASI_Hs01_00242766 predicted 874
10 SASI_Hs01_00242767 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200238 predicted 1104
2 SASI_Rn02_00200239 predicted 671
3 SASI_Rn02_00200240 predicted 1813
4 SASI_Rn02_00200241 predicted 1655
5 SASI_Rn02_00200242 predicted 359
6 SASI_Rn02_00200243 predicted 1604
7 SASI_Rn02_00200244 predicted 813
8 SASI_Rn02_00200245 predicted 590
9 SASI_Rn02_00200246 predicted 512
10 SASI_Rn02_00200247 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288375 predicted 1103
2 SASI_Rn02_00288376 predicted 671
3 SASI_Rn02_00288377 predicted 1810
4 SASI_Rn02_00288378 predicted 1657
5 SASI_Rn02_00288379 predicted 361
6 SASI_Rn02_00288380 predicted 1603
7 SASI_Rn02_00288381 predicted 816
8 SASI_Rn02_00288382 predicted 588
9 SASI_Rn02_00288383 predicted 517
10 SASI_Rn02_00288384 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575840 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404424 predicted 396
2 SASI_Rn02_00404425 predicted 299
3 SASI_Rn02_00404426 predicted 418
4 SASI_Rn02_00404427 predicted 345
5 SASI_Rn02_00404428 predicted 357
6 SASI_Rn02_00404429 predicted 325
7 SASI_Rn02_00404430 predicted 305
8 SASI_Rn02_00404431 predicted 420
9 SASI_Rn02_00404432 predicted 414
10 SASI_Rn02_00404433 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136813 predicted 1071
2 SASI_Mm01_00136814 predicted 611
3 SASI_Mm02_00318948 predicted 370
4 SASI_Mm01_00136816 predicted 1050
5 SASI_Mm01_00136817 predicted 672
6 SASI_Mm01_00136818 predicted 1673
7 SASI_Mm02_00318949 predicted 955
8 SASI_Mm01_00136819 predicted 831
9 SASI_Mm01_00136820 predicted 533
10 SASI_Mm01_00136821 predicted 1010
11 SASI_Mm01_00136815 predicted 965
12 SASI_Mm01_00136822 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010616
KIF12 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-1165s21c1
Sequence:CCGGACTCTCAGCACTCTGCGATATCTCGAGATATCGCAGAGTGCTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-774s21c1
Sequence:CCGGGAGCTCCTCACATACCTTGAACTCGAGTTCAAGGTATGTGAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-984s21c1
Sequence:CCGGCAACCGCAGCCTATTGGCATTCTCGAGAATGCCAATAGGCTGCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-533s21c1
Sequence:CCGGGGACCTTCACCTGGCTATTAGCTCGAGCTAATAGCCAGGTGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010616.1-2090s1c1
Sequence:CCGGCCATCTCTCTGTCTGTGAATTCTCGAGAATTCACAGACAGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-1610s1c1
Sequence:CCGGCCTCTGTTACTGCCACCACTTCTCGAGAAGTGGTGGCAGTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-2036s1c1
Sequence:CCGGCCAAGGCCTCTCTTCTTGTTACTCGAGTAACAAGAAGAGAGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-186s1c1
Sequence:CCGGGAAGGATCAGAAACTCCCATTCTCGAGAATGGGAGTTTCTGATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-1394s1c1
Sequence:CCGGGCAGGAGTTTATGCTGGAGAACTCGAGTTCTCCAGCATAAACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010616
KIF12 MISSION shRNA shRNA Plasmid DNA
kinesin family member 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-1165s21c1
Sequence:CCGGACTCTCAGCACTCTGCGATATCTCGAGATATCGCAGAGTGCTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-774s21c1
Sequence:CCGGGAGCTCCTCACATACCTTGAACTCGAGTTCAAGGTATGTGAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-984s21c1
Sequence:CCGGCAACCGCAGCCTATTGGCATTCTCGAGAATGCCAATAGGCTGCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-533s21c1
Sequence:CCGGGGACCTTCACCTGGCTATTAGCTCGAGCTAATAGCCAGGTGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010616.1-2090s1c1
Sequence:CCGGCCATCTCTCTGTCTGTGAATTCTCGAGAATTCACAGACAGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-1610s1c1
Sequence:CCGGCCTCTGTTACTGCCACCACTTCTCGAGAAGTGGTGGCAGTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-2036s1c1
Sequence:CCGGCCAAGGCCTCTCTTCTTGTTACTCGAGTAACAAGAAGAGAGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-186s1c1
Sequence:CCGGGAAGGATCAGAAACTCCCATTCTCGAGAATGGGAGTTTCTGATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-1394s1c1
Sequence:CCGGGCAGGAGTTTATGCTGGAGAACTCGAGTTCTCCAGCATAAACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010616
KIF12 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-1165s21c1
Sequence:CCGGACTCTCAGCACTCTGCGATATCTCGAGATATCGCAGAGTGCTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-774s21c1
Sequence:CCGGGAGCTCCTCACATACCTTGAACTCGAGTTCAAGGTATGTGAGGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-984s21c1
Sequence:CCGGCAACCGCAGCCTATTGGCATTCTCGAGAATGCCAATAGGCTGCGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010616.2-533s21c1
Sequence:CCGGGGACCTTCACCTGGCTATTAGCTCGAGCTAATAGCCAGGTGAAGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090393    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010616.1-2090s1c1
Sequence:CCGGCCATCTCTCTGTCTGTGAATTCTCGAGAATTCACAGACAGAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-1610s1c1
Sequence:CCGGCCTCTGTTACTGCCACCACTTCTCGAGAAGTGGTGGCAGTAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090397    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-2036s1c1
Sequence:CCGGCCAAGGCCTCTCTTCTTGTTACTCGAGTAACAAGAAGAGAGGCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-186s1c1
Sequence:CCGGGAAGGATCAGAAACTCCCATTCTCGAGAATGGGAGTTTCTGATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010616.1-1394s1c1
Sequence:CCGGGCAGGAGTTTATGCTGGAGAACTCGAGTTCTCCAGCATAAACTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138424
KIF12 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138424.1-1203s21c1
Sequence:CCGGAGCAGGTCCATGCACTAGAGACTCGAGTCTCTAGTGCATGGACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138424.1-671s21c1
Sequence:CCGGGAGCTGATGCTTGAGGCTAACCTCGAGGTTAGCCTCAAGCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-540s1c1
Sequence:CCGGCCCTTTACATCAGCCGTCAAACTCGAGTTTGACGGCTGATGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-1105s1c1
Sequence:CCGGACAGGAGTTCATGCTAGAGAACTCGAGTTCTCTAGCATGAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-317s1c1
Sequence:CCGGGAGATCTACAATGAGCAGGTTCTCGAGAACCTGCTCATTGTAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-1085s1c1
Sequence:CCGGCGGAACCTGTACGGGATGCTACTCGAGTAGCATCCCGTACAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-539s1c1
Sequence:CCGGACCCTTTACATCAGCCGTCAACTCGAGTTGACGGCTGATGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138424
KIF12 MISSION shRNA shRNA Plasmid DNA
kinesin family member 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138424.1-1203s21c1
Sequence:CCGGAGCAGGTCCATGCACTAGAGACTCGAGTCTCTAGTGCATGGACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138424.1-671s21c1
Sequence:CCGGGAGCTGATGCTTGAGGCTAACCTCGAGGTTAGCCTCAAGCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-540s1c1
Sequence:CCGGCCCTTTACATCAGCCGTCAAACTCGAGTTTGACGGCTGATGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-1105s1c1
Sequence:CCGGACAGGAGTTCATGCTAGAGAACTCGAGTTCTCTAGCATGAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-317s1c1
Sequence:CCGGGAGATCTACAATGAGCAGGTTCTCGAGAACCTGCTCATTGTAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-1085s1c1
Sequence:CCGGCGGAACCTGTACGGGATGCTACTCGAGTAGCATCCCGTACAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-539s1c1
Sequence:CCGGACCCTTTACATCAGCCGTCAACTCGAGTTGACGGCTGATGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138424
KIF12 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138424.1-1203s21c1
Sequence:CCGGAGCAGGTCCATGCACTAGAGACTCGAGTCTCTAGTGCATGGACCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138424.1-671s21c1
Sequence:CCGGGAGCTGATGCTTGAGGCTAACCTCGAGGTTAGCCTCAAGCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-540s1c1
Sequence:CCGGCCCTTTACATCAGCCGTCAAACTCGAGTTTGACGGCTGATGTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-1105s1c1
Sequence:CCGGACAGGAGTTCATGCTAGAGAACTCGAGTTCTCTAGCATGAACTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-317s1c1
Sequence:CCGGGAGATCTACAATGAGCAGGTTCTCGAGAACCTGCTCATTGTAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-1085s1c1
Sequence:CCGGCGGAACCTGTACGGGATGCTACTCGAGTAGCATCCCGTACAGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138424.1-539s1c1
Sequence:CCGGACCCTTTACATCAGCCGTCAACTCGAGTTGACGGCTGATGTAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks