EMAIL THIS PAGE TO A FRIEND

KIF17

kinesin family member 17

Synonyms: KIF17B KIF3X KLP-2 OSM-3
Gene ID:
Mouse(16559) kinesin family member 17
Zebrafish(557863) kinesin family member 17
chicken(101748949) kinesin family member 17
dog(100688382) kinesin family member 17
domestic cat(101093285) kinesin family member 17
cow(530435) kinesin family member 17
Horse(100058362) kinesin family member 17
chicken(101669723) kinesin family member 17
domestic guinea pig(100727039) kinesin family member 17
naked mole-rat(101716965) kinesin family member 17
sheep(101101877) kinesin family member 17
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020816 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020816 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020816 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062821 MISSION® esiRNA esiRNA human KIF17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122819 Rosetta Predictions human pricing
NM_020816 Rosetta Predictions human pricing
NM_010623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327355 predicted 3428
2 SASI_Hs02_00327356 predicted 1560
3 SASI_Hs02_00327357 predicted 1704
4 SASI_Hs02_00327358 predicted 1827
5 SASI_Hs02_00327359 predicted 2498
6 SASI_Hs02_00327360 predicted 1119
7 SASI_Hs02_00327361 predicted 1058
8 SASI_Hs02_00327362 predicted 3401
9 SASI_Hs02_00327363 predicted 2138
10 SASI_Hs02_00327364 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020816 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354013 predicted 3429
2 SASI_Hs01_00098618 predicted 1563
3 SASI_Hs02_00354014 predicted 1696
4 SASI_Hs01_00098620 predicted 1826
5 SASI_Hs01_00098621 predicted 2498
6 SASI_Hs01_00098623 predicted 1118
7 SASI_Hs02_00354015 predicted 1060
8 SASI_Hs02_00354016 predicted 3398
9 SASI_Hs01_00098624 predicted 2134
10 SASI_Hs02_00354017 predicted 1121
11 SASI_Hs01_00098617 predicted 3083
12 SASI_Hs01_00098619 predicted 806
13 SASI_Hs01_00098622 predicted 3163
14 SASI_Hs01_00098625 predicted 2910
15 SASI_Hs01_00098626 predicted 2493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175948 predicted 644
2 SASI_Mm01_00175949 predicted 1552
3 SASI_Mm01_00175950 predicted 904
4 SASI_Mm01_00175951 predicted 892
5 SASI_Mm01_00175952 predicted 418
6 SASI_Mm01_00175953 predicted 3008
7 SASI_Mm01_00175954 predicted 1248
8 SASI_Mm01_00175955 predicted 2939
9 SASI_Mm01_00175956 predicted 1189
10 SASI_Mm01_00175957 predicted 1513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010623
KIF17 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 17
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-2962s1c1
Sequence:CCGGCCCAGATCCCATCATACTGAACTCGAGTTCAGTATGATGGGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-418s1c1
Sequence:CCGGCGCCTACTACATAGAACACTTCTCGAGAAGTGTTCTATGTAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-1190s1c1
Sequence:CCGGCCCGCAGACAACAATTACGATCTCGAGATCGTAATTGTTGTCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-3100s1c1
Sequence:CCGGCCGAAGCGACAGTGAGAATATCTCGAGATATTCTCACTGTCGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-2281s1c1
Sequence:CCGGGCCTGATGTAAACCTGAGAGTCTCGAGACTCTCAGGTTTACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010623
KIF17 MISSION shRNA shRNA Plasmid DNA
kinesin family member 17
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-2962s1c1
Sequence:CCGGCCCAGATCCCATCATACTGAACTCGAGTTCAGTATGATGGGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-418s1c1
Sequence:CCGGCGCCTACTACATAGAACACTTCTCGAGAAGTGTTCTATGTAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-1190s1c1
Sequence:CCGGCCCGCAGACAACAATTACGATCTCGAGATCGTAATTGTTGTCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-3100s1c1
Sequence:CCGGCCGAAGCGACAGTGAGAATATCTCGAGATATTCTCACTGTCGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-2281s1c1
Sequence:CCGGGCCTGATGTAAACCTGAGAGTCTCGAGACTCTCAGGTTTACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010623
KIF17 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 17
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-2962s1c1
Sequence:CCGGCCCAGATCCCATCATACTGAACTCGAGTTCAGTATGATGGGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-418s1c1
Sequence:CCGGCGCCTACTACATAGAACACTTCTCGAGAAGTGTTCTATGTAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-1190s1c1
Sequence:CCGGCCCGCAGACAACAATTACGATCTCGAGATCGTAATTGTTGTCTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-3100s1c1
Sequence:CCGGCCGAAGCGACAGTGAGAATATCTCGAGATATTCTCACTGTCGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010623.2-2281s1c1
Sequence:CCGGGCCTGATGTAAACCTGAGAGTCTCGAGACTCTCAGGTTTACATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020816
KIF17 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020816.1-3594s1c1
Sequence:CCGGGAGGCTGTATAGTCCTCCTTACTCGAGTAAGGAGGACTATACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-1563s1c1
Sequence:CCGGCCCGGCTGAAAGCCGACTATACTCGAGTATAGTCGGCTTTCAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-3156s1c1
Sequence:CCGGCCAGCAACTACTTCCGATCTACTCGAGTAGATCGGAAGTAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-1883s1c1
Sequence:CCGGCCCAAGGTGGAACCCTCCAAACTCGAGTTTGGAGGGTTCCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-502s1c1
Sequence:CCGGCGAGCAGATCTACAACGAGATCTCGAGATCTCGTTGTAGATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020816.2-1738s21c1
Sequence:CCGGGTCATCCTCGCTCGAAGAAACCTCGAGGTTTCTTCGAGCGAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020816.2-2847s21c1
Sequence:CCGGCAACTGGGCCACAGAACAAACCTCGAGGTTTGTTCTGTGGCCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020816.2-3504s21c1
Sequence:CCGGGTGTTGGTCTTTGCCTCAAAGCTCGAGCTTTGAGGCAAAGACCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020816
KIF17 MISSION shRNA shRNA Plasmid DNA
kinesin family member 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020816.1-3594s1c1
Sequence:CCGGGAGGCTGTATAGTCCTCCTTACTCGAGTAAGGAGGACTATACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-1563s1c1
Sequence:CCGGCCCGGCTGAAAGCCGACTATACTCGAGTATAGTCGGCTTTCAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-3156s1c1
Sequence:CCGGCCAGCAACTACTTCCGATCTACTCGAGTAGATCGGAAGTAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-1883s1c1
Sequence:CCGGCCCAAGGTGGAACCCTCCAAACTCGAGTTTGGAGGGTTCCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-502s1c1
Sequence:CCGGCGAGCAGATCTACAACGAGATCTCGAGATCTCGTTGTAGATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020816.2-1738s21c1
Sequence:CCGGGTCATCCTCGCTCGAAGAAACCTCGAGGTTTCTTCGAGCGAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020816.2-2847s21c1
Sequence:CCGGCAACTGGGCCACAGAACAAACCTCGAGGTTTGTTCTGTGGCCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020816.2-3504s21c1
Sequence:CCGGGTGTTGGTCTTTGCCTCAAAGCTCGAGCTTTGAGGCAAAGACCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020816
KIF17 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020816.1-3594s1c1
Sequence:CCGGGAGGCTGTATAGTCCTCCTTACTCGAGTAAGGAGGACTATACAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-1563s1c1
Sequence:CCGGCCCGGCTGAAAGCCGACTATACTCGAGTATAGTCGGCTTTCAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-3156s1c1
Sequence:CCGGCCAGCAACTACTTCCGATCTACTCGAGTAGATCGGAAGTAGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-1883s1c1
Sequence:CCGGCCCAAGGTGGAACCCTCCAAACTCGAGTTTGGAGGGTTCCACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020816.1-502s1c1
Sequence:CCGGCGAGCAGATCTACAACGAGATCTCGAGATCTCGTTGTAGATCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020816.2-1738s21c1
Sequence:CCGGGTCATCCTCGCTCGAAGAAACCTCGAGGTTTCTTCGAGCGAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020816.2-2847s21c1
Sequence:CCGGCAACTGGGCCACAGAACAAACCTCGAGGTTTGTTCTGTGGCCCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020816.2-3504s21c1
Sequence:CCGGGTGTTGGTCTTTGCCTCAAAGCTCGAGCTTTGAGGCAAAGACCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks