EMAIL THIS PAGE TO A FRIEND

KIF18A

kinesin family member 18A

Synonyms: MS-KIF18A
UniProtKB ID: Q8NI77, Q4VPE3, Q86VS5, Q9H0F3
Gene ID:
Human(81930) Summary: KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]
Mouse(228421) kinesin family member 18A
Rat(362186) kinesin family member 18A
sheep(101117696) kinesin family member 18A
Domestic Rabbit(100345219) kinesin family member 18A
domestic guinea pig(100729982) kinesin family member 18A
naked mole-rat(101705041) kinesin family member 18A
Zebrafish(393209) kinesin family member 18A
domestic cat(101082944) kinesin family member 18A
cow(537566) kinesin family member 18A
Horse(100057621) kinesin family member 18A
dog(485426) kinesin family member 18A
chicken(421607) kinesin family member 18A
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031217 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_139303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031217 Rosetta Predictions human pricing
XM_342486 Rosetta Predictions rat pricing
NM_139303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146166 predicted 816
2 SASI_Hs02_00358633 predicted 1138
3 SASI_Hs01_00146169 predicted 1841
4 SASI_Hs01_00146170 predicted 2532
5 SASI_Hs01_00146171 predicted 2504
6 SASI_Hs01_00146172 predicted 2144
7 SASI_Hs01_00146173 predicted 2116
8 SASI_Hs01_00146174 predicted 1676
9 SASI_Hs02_00358634 predicted 2062
10 SASI_Hs01_00146175 predicted 2206
11 SASI_Hs01_00146167 predicted 482
12 SASI_Hs01_00146168 predicted 1959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342486 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394339 predicted 1284
2 SASI_Rn02_00394340 predicted 1114
3 SASI_Rn02_00394341 predicted 1646
4 SASI_Rn02_00394342 predicted 1206
5 SASI_Rn02_00394343 predicted 1556
6 SASI_Rn02_00394344 predicted 1920
7 SASI_Rn02_00394345 predicted 1298
8 SASI_Rn02_00394346 predicted 1458
9 SASI_Rn02_00394347 predicted 2096
10 SASI_Rn02_00394348 predicted 1512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193720 predicted 1187
2 SASI_Mm02_00339994 predicted 1228
3 SASI_Mm01_00193721 predicted 1853
4 SASI_Mm02_00339995 predicted 2878
5 SASI_Mm01_00193725 predicted 502
6 SASI_Mm02_00339996 predicted 218
7 SASI_Mm01_00193727 predicted 2299
8 SASI_Mm02_00339997 predicted 2481
9 SASI_Mm01_00193728 predicted 1582
10 SASI_Mm01_00193729 predicted 476
11 SASI_Mm01_00193722 predicted 2079
12 SASI_Mm01_00193723 predicted 1315
13 SASI_Mm01_00193724 predicted 2555
14 SASI_Mm01_00193726 predicted 2054
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031217
KIF18A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 18A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-1826s21c1
Sequence:CCGGGAAAGCACAAATTAGACATATCTCGAGATATGTCTAATTTGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-1193s21c1
Sequence:CCGGATTCTACGATGACACATATAACTCGAGTTATATGTGTCATCGTAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-2210s21c1
Sequence:CCGGGAAAGGACAGCATACTCTAAACTCGAGTTTAGAGTATGCTGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-744s21c1
Sequence:CCGGGTCGTTCATGGACTTACTTTACTCGAGTAAAGTAAGTCCATGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031217.2-2879s1c1
Sequence:CCGGCCCATCTTAAAGCTAAGTTTACTCGAGTAAACTTAGCTTTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-2613s1c1
Sequence:CCGGGCAGACGTAAATTCTGGATTTCTCGAGAAATCCAGAATTTACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-2156s1c1
Sequence:CCGGGCTCAATGATTCTCTTAGCAACTCGAGTTGCTAAGAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-901s1c1
Sequence:CCGGCCCGATTTGTAGAAGGCACAACTCGAGTTGTGCCTTCTACAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-1023s1c1
Sequence:CCGGCGCTTGTTAAAGGATTCTCTTCTCGAGAAGAGAATCCTTTAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031217
KIF18A MISSION shRNA shRNA Plasmid DNA
kinesin family member 18A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-1826s21c1
Sequence:CCGGGAAAGCACAAATTAGACATATCTCGAGATATGTCTAATTTGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-1193s21c1
Sequence:CCGGATTCTACGATGACACATATAACTCGAGTTATATGTGTCATCGTAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-2210s21c1
Sequence:CCGGGAAAGGACAGCATACTCTAAACTCGAGTTTAGAGTATGCTGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-744s21c1
Sequence:CCGGGTCGTTCATGGACTTACTTTACTCGAGTAAAGTAAGTCCATGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031217.2-2879s1c1
Sequence:CCGGCCCATCTTAAAGCTAAGTTTACTCGAGTAAACTTAGCTTTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-2613s1c1
Sequence:CCGGGCAGACGTAAATTCTGGATTTCTCGAGAAATCCAGAATTTACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-2156s1c1
Sequence:CCGGGCTCAATGATTCTCTTAGCAACTCGAGTTGCTAAGAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-901s1c1
Sequence:CCGGCCCGATTTGTAGAAGGCACAACTCGAGTTGTGCCTTCTACAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-1023s1c1
Sequence:CCGGCGCTTGTTAAAGGATTCTCTTCTCGAGAAGAGAATCCTTTAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031217
KIF18A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 18A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-1826s21c1
Sequence:CCGGGAAAGCACAAATTAGACATATCTCGAGATATGTCTAATTTGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-1193s21c1
Sequence:CCGGATTCTACGATGACACATATAACTCGAGTTATATGTGTCATCGTAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-2210s21c1
Sequence:CCGGGAAAGGACAGCATACTCTAAACTCGAGTTTAGAGTATGCTGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031217.3-744s21c1
Sequence:CCGGGTCGTTCATGGACTTACTTTACTCGAGTAAAGTAAGTCCATGAACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031217.2-2879s1c1
Sequence:CCGGCCCATCTTAAAGCTAAGTTTACTCGAGTAAACTTAGCTTTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-2613s1c1
Sequence:CCGGGCAGACGTAAATTCTGGATTTCTCGAGAAATCCAGAATTTACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-2156s1c1
Sequence:CCGGGCTCAATGATTCTCTTAGCAACTCGAGTTGCTAAGAGAATCATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-901s1c1
Sequence:CCGGCCCGATTTGTAGAAGGCACAACTCGAGTTGTGCCTTCTACAAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031217.2-1023s1c1
Sequence:CCGGCGCTTGTTAAAGGATTCTCTTCTCGAGAAGAGAATCCTTTAACAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139303
VALIDATED
KIF18A MISSION shRNA Bacterial Glycerol Stock
kinesin family member 18A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-298s21c1
Sequence:CCGGGTGGTTCATGTAGTGGATAAACTCGAGTTTATCCACTACATGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-2767s21c1
Sequence:CCGGAGACTGAAAGTGGGCTATAAACTCGAGTTTATAGCCCACTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-2721s21c1
Sequence:CCGGACGCATTCGACGGGATAATTCCTCGAGGAATTATCCCGTCGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139303.1-777s21c1
Sequence:CCGGTACTCTACACCAGCCTAAATCCTCGAGGATTTAGGCTGGTGTAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-3054s21c1
Sequence:CCGGGTCACCATGATGCCAATTTACCTCGAGGTAAATTGGCATCATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139303.1-3309s1c1
Sequence:CCGGCCTTCCATAAATAATGTGCTACTCGAGTAGCACATTATTTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139303.1-2050s1c1
Sequence:CCGGGCTGACCAAACTAATGAACATCTCGAGATGTTCATTAGTTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139303.1-1827s1c1
Sequence:CCGGCCTCCAGAACAAAGAACTGAACTCGAGTTCAGTTCTTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139303.1-1021s1c1
Sequence:CCGGCGATTTGTAGAAGGCACAAATCTCGAGATTTGTGCCTTCTACAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139303.1-2405s1c1
Sequence:CCGGCCCAGAAAGCACTGTGTAGAACTCGAGTTCTACACAGTGCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139303
VALIDATED
KIF18A MISSION shRNA shRNA Plasmid DNA
kinesin family member 18A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-298s21c1
Sequence:CCGGGTGGTTCATGTAGTGGATAAACTCGAGTTTATCCACTACATGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-2767s21c1
Sequence:CCGGAGACTGAAAGTGGGCTATAAACTCGAGTTTATAGCCCACTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-2721s21c1
Sequence:CCGGACGCATTCGACGGGATAATTCCTCGAGGAATTATCCCGTCGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139303.1-777s21c1
Sequence:CCGGTACTCTACACCAGCCTAAATCCTCGAGGATTTAGGCTGGTGTAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-3054s21c1
Sequence:CCGGGTCACCATGATGCCAATTTACCTCGAGGTAAATTGGCATCATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139303.1-3309s1c1
Sequence:CCGGCCTTCCATAAATAATGTGCTACTCGAGTAGCACATTATTTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139303.1-2050s1c1
Sequence:CCGGGCTGACCAAACTAATGAACATCTCGAGATGTTCATTAGTTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139303.1-1827s1c1
Sequence:CCGGCCTCCAGAACAAAGAACTGAACTCGAGTTCAGTTCTTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139303.1-1021s1c1
Sequence:CCGGCGATTTGTAGAAGGCACAAATCTCGAGATTTGTGCCTTCTACAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139303.1-2405s1c1
Sequence:CCGGCCCAGAAAGCACTGTGTAGAACTCGAGTTCTACACAGTGCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139303
VALIDATED
KIF18A MISSION shRNA Lentiviral Transduction Particles
kinesin family member 18A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-298s21c1
Sequence:CCGGGTGGTTCATGTAGTGGATAAACTCGAGTTTATCCACTACATGAACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-2767s21c1
Sequence:CCGGAGACTGAAAGTGGGCTATAAACTCGAGTTTATAGCCCACTTTCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-2721s21c1
Sequence:CCGGACGCATTCGACGGGATAATTCCTCGAGGAATTATCCCGTCGAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139303.1-777s21c1
Sequence:CCGGTACTCTACACCAGCCTAAATCCTCGAGGATTTAGGCTGGTGTAGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352533    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_139303.1-3054s21c1
Sequence:CCGGGTCACCATGATGCCAATTTACCTCGAGGTAAATTGGCATCATGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091623    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139303.1-3309s1c1
Sequence:CCGGCCTTCCATAAATAATGTGCTACTCGAGTAGCACATTATTTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139303.1-2050s1c1
Sequence:CCGGGCTGACCAAACTAATGAACATCTCGAGATGTTCATTAGTTTGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139303.1-1827s1c1
Sequence:CCGGCCTCCAGAACAAAGAACTGAACTCGAGTTCAGTTCTTTGTTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139303.1-1021s1c1
Sequence:CCGGCGATTTGTAGAAGGCACAAATCTCGAGATTTGTGCCTTCTACAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_139303.1-2405s1c1
Sequence:CCGGCCCAGAAAGCACTGTGTAGAACTCGAGTTCTACACAGTGCTTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks