EMAIL THIS PAGE TO A FRIEND

KIF1C

kinesin family member 1C

Synonyms: LTXS1
UniProtKB ID: O43896, D3DTL6, O75186, Q5U618
Gene ID:
Mouse(16562) kinesin family member 1C
Rat(113886) kinesin family member 1C
sheep(101107535) kinesin family member 1C
domestic guinea pig(100724827) kinesin family member 1C
naked mole-rat(101724364) kinesin family member 1C
Zebrafish(570771) kinesin family member 1C
Zebrafish(100535661) kinesin family member 1C
cow(514928) kinesin family member 1C
Horse(100072836) kinesin family member 1C
domestic cat(101091058) kinesin family member 1C
dog(489453) kinesin family member 1C
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006612 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006612 Rosetta Predictions human pricing
NM_145877 Rosetta Predictions rat pricing
XM_579675 Rosetta Predictions rat pricing
NM_153103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043002 predicted 766
2 SASI_Hs01_00043003 predicted 1391
3 SASI_Hs02_00341948 predicted 2947
4 SASI_Hs01_00043004 predicted 360
5 SASI_Hs01_00043005 predicted 1361
6 SASI_Hs01_00043006 predicted 981
7 SASI_Hs01_00043007 predicted 2356
8 SASI_Hs01_00043008 predicted 1130
9 SASI_Hs01_00043009 predicted 2331
10 SASI_Hs02_00341949 predicted 1310
11 SASI_Hs01_00043010 predicted 589
12 SASI_Hs01_00043011 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053859 predicted 1157
2 SASI_Rn01_00053860 predicted 695
3 SASI_Rn01_00053861 predicted 2148
4 SASI_Rn01_00053862 predicted 972
5 SASI_Rn01_00053863 predicted 2851
6 SASI_Rn01_00053864 predicted 2281
7 SASI_Rn01_00053865 predicted 411
8 SASI_Rn02_00268801 predicted 2413
9 SASI_Rn02_00268802 predicted 2254
10 SASI_Rn02_00268803 predicted 1061
11 SASI_Rn01_00053866 predicted 2775
12 SASI_Rn01_00053867 predicted 1286
13 SASI_Rn01_00053868 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125044 predicted 2796
2 SASI_Rn01_00125045 predicted 686
3 SASI_Rn01_00125046 predicted 1196
4 SASI_Rn01_00125047 predicted 1366
5 SASI_Rn01_00125048 predicted 3658
6 SASI_Rn01_00125049 predicted 1119
7 SASI_Rn01_00125050 predicted 2776
8 SASI_Rn01_00125051 predicted 2693
9 SASI_Rn01_00125052 predicted 1211
10 SASI_Rn01_00125053 predicted 2660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094883 predicted 1709
2 SASI_Mm01_00094884 predicted 2613
3 SASI_Mm01_00094885 predicted 1753
4 SASI_Mm01_00094886 predicted 1891
5 SASI_Mm01_00094887 predicted 2340
6 SASI_Mm01_00094888 predicted 2124
7 SASI_Mm01_00094889 predicted 2533
8 SASI_Mm02_00342952 predicted 401
9 SASI_Mm01_00094891 predicted 1022
10 SASI_Mm01_00094892 predicted 1897
11 SASI_Mm01_00094890 predicted 662
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006612
KIF1C MISSION shRNA Bacterial Glycerol Stock
kinesin family member 1C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-2225s21c1
Sequence:CCGGGCAGCAAGGCATCGACATAAACTCGAGTTTATGTCGATGCCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-353s21c1
Sequence:CCGGAGTGAGGGTTCGGCCCTTTAACTCGAGTTAAAGGGCCGAACCCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-1035s21c1
Sequence:CCGGGACTCGGAGAAGGTCAGTAAGCTCGAGCTTACTGACCTTCTCCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-1300s21c1
Sequence:CCGGTGAGCCCTGCTGACATCAATTCTCGAGAATTGATGTCAGCAGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-1183s1c1
Sequence:CCGGCCTTGCAGATATGCAATCAAACTCGAGTTTGATTGCATATCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-913s1c1
Sequence:CCGGCCTCATGGACTGTGGAAATAACTCGAGTTATTTCCACAGTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-1909s1c1
Sequence:CCGGCCAAGTAGATATGGACATCAACTCGAGTTGATGTCCATATCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-2279s1c1
Sequence:CCGGCTGGAGAATCAGTACCGGAAACTCGAGTTTCCGGTACTGATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006612.3-3833s1c1
Sequence:CCGGCCAGGAGCAAACCAAAGTGAACTCGAGTTCACTTTGGTTTGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006612
KIF1C MISSION shRNA shRNA Plasmid DNA
kinesin family member 1C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-2225s21c1
Sequence:CCGGGCAGCAAGGCATCGACATAAACTCGAGTTTATGTCGATGCCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-353s21c1
Sequence:CCGGAGTGAGGGTTCGGCCCTTTAACTCGAGTTAAAGGGCCGAACCCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-1035s21c1
Sequence:CCGGGACTCGGAGAAGGTCAGTAAGCTCGAGCTTACTGACCTTCTCCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-1300s21c1
Sequence:CCGGTGAGCCCTGCTGACATCAATTCTCGAGAATTGATGTCAGCAGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-1183s1c1
Sequence:CCGGCCTTGCAGATATGCAATCAAACTCGAGTTTGATTGCATATCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-913s1c1
Sequence:CCGGCCTCATGGACTGTGGAAATAACTCGAGTTATTTCCACAGTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-1909s1c1
Sequence:CCGGCCAAGTAGATATGGACATCAACTCGAGTTGATGTCCATATCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-2279s1c1
Sequence:CCGGCTGGAGAATCAGTACCGGAAACTCGAGTTTCCGGTACTGATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006612.3-3833s1c1
Sequence:CCGGCCAGGAGCAAACCAAAGTGAACTCGAGTTCACTTTGGTTTGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006612
KIF1C MISSION shRNA Lentiviral Transduction Particles
kinesin family member 1C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-2225s21c1
Sequence:CCGGGCAGCAAGGCATCGACATAAACTCGAGTTTATGTCGATGCCTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-353s21c1
Sequence:CCGGAGTGAGGGTTCGGCCCTTTAACTCGAGTTAAAGGGCCGAACCCTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-1035s21c1
Sequence:CCGGGACTCGGAGAAGGTCAGTAAGCTCGAGCTTACTGACCTTCTCCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006612.4-1300s21c1
Sequence:CCGGTGAGCCCTGCTGACATCAATTCTCGAGAATTGATGTCAGCAGGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-1183s1c1
Sequence:CCGGCCTTGCAGATATGCAATCAAACTCGAGTTTGATTGCATATCTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-913s1c1
Sequence:CCGGCCTCATGGACTGTGGAAATAACTCGAGTTATTTCCACAGTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-1909s1c1
Sequence:CCGGCCAAGTAGATATGGACATCAACTCGAGTTGATGTCCATATCTACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006612.3-2279s1c1
Sequence:CCGGCTGGAGAATCAGTACCGGAAACTCGAGTTTCCGGTACTGATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116587    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006612.3-3833s1c1
Sequence:CCGGCCAGGAGCAAACCAAAGTGAACTCGAGTTCACTTTGGTTTGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153103
VALIDATED
KIF1C MISSION shRNA Bacterial Glycerol Stock
kinesin family member 1C
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-1317s21c1
Sequence:CCGGACTCTCGCACAGCAATGATTGCTCGAGCAATCATTGCTGTGCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-790s21c1
Sequence:CCGGTTCAGTAGAGGTGAGCTATATCTCGAGATATAGCTCACCTCTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153103.2-4140s21c1
Sequence:CCGGTTCCAGGCCTCCTGCTATATTCTCGAGAATATAGCAGGAGGCCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-2621s21c1
Sequence:CCGGGCAGTAAAGGAGATATGCTATCTCGAGATAGCATATCTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-1522s21c1
Sequence:CCGGCTCTGCTCTAGGAGGTCTAAACTCGAGTTTAGACCTCCTAGAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153103.2-4053s21c1
Sequence:CCGGGCTCTTGTCTGTCCGTCTATCCTCGAGGATAGACGGACAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-656s1c1
Sequence:CCGGCCGTCTTTACTATTGTCTTTACTCGAGTAAAGACAATAGTAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-2251s1c1
Sequence:CCGGGCAGTAAAGGAGATATGCTATCTCGAGATAGCATATCTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-430s1c1
Sequence:CCGGGTGAGCTATATGGAAATCTATCTCGAGATAGATTTCCATATAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-1522s1c1
Sequence:CCGGCCCTTGATGTCTGAATGTCTTCTCGAGAAGACATTCAGACATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-655s1c1
Sequence:CCGGGCCGTCTTTACTATTGTCTTTCTCGAGAAAGACAATAGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153103
VALIDATED
KIF1C MISSION shRNA shRNA Plasmid DNA
kinesin family member 1C
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-1317s21c1
Sequence:CCGGACTCTCGCACAGCAATGATTGCTCGAGCAATCATTGCTGTGCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-790s21c1
Sequence:CCGGTTCAGTAGAGGTGAGCTATATCTCGAGATATAGCTCACCTCTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153103.2-4140s21c1
Sequence:CCGGTTCCAGGCCTCCTGCTATATTCTCGAGAATATAGCAGGAGGCCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-2621s21c1
Sequence:CCGGGCAGTAAAGGAGATATGCTATCTCGAGATAGCATATCTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-1522s21c1
Sequence:CCGGCTCTGCTCTAGGAGGTCTAAACTCGAGTTTAGACCTCCTAGAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153103.2-4053s21c1
Sequence:CCGGGCTCTTGTCTGTCCGTCTATCCTCGAGGATAGACGGACAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-656s1c1
Sequence:CCGGCCGTCTTTACTATTGTCTTTACTCGAGTAAAGACAATAGTAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-2251s1c1
Sequence:CCGGGCAGTAAAGGAGATATGCTATCTCGAGATAGCATATCTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-430s1c1
Sequence:CCGGGTGAGCTATATGGAAATCTATCTCGAGATAGATTTCCATATAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-1522s1c1
Sequence:CCGGCCCTTGATGTCTGAATGTCTTCTCGAGAAGACATTCAGACATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-655s1c1
Sequence:CCGGGCCGTCTTTACTATTGTCTTTCTCGAGAAAGACAATAGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153103
VALIDATED
KIF1C MISSION shRNA Lentiviral Transduction Particles
kinesin family member 1C
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-1317s21c1
Sequence:CCGGACTCTCGCACAGCAATGATTGCTCGAGCAATCATTGCTGTGCGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-790s21c1
Sequence:CCGGTTCAGTAGAGGTGAGCTATATCTCGAGATATAGCTCACCTCTACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153103.2-4140s21c1
Sequence:CCGGTTCCAGGCCTCCTGCTATATTCTCGAGAATATAGCAGGAGGCCTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-2621s21c1
Sequence:CCGGGCAGTAAAGGAGATATGCTATCTCGAGATAGCATATCTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153103.2-1522s21c1
Sequence:CCGGCTCTGCTCTAGGAGGTCTAAACTCGAGTTTAGACCTCCTAGAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153103.2-4053s21c1
Sequence:CCGGGCTCTTGTCTGTCCGTCTATCCTCGAGGATAGACGGACAGACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-656s1c1
Sequence:CCGGCCGTCTTTACTATTGTCTTTACTCGAGTAAAGACAATAGTAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-2251s1c1
Sequence:CCGGGCAGTAAAGGAGATATGCTATCTCGAGATAGCATATCTCCTTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-430s1c1
Sequence:CCGGGTGAGCTATATGGAAATCTATCTCGAGATAGATTTCCATATAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-1522s1c1
Sequence:CCGGCCCTTGATGTCTGAATGTCTTCTCGAGAAGACATTCAGACATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_153103.1-655s1c1
Sequence:CCGGGCCGTCTTTACTATTGTCTTTCTCGAGAAAGACAATAGTAAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks