EMAIL THIS PAGE TO A FRIEND

KIF26B

kinesin family member 26B

UniProtKB ID: Q2KJY2, Q6ZQR9, Q6ZUZ0, Q8IUN3, Q8IVR1, Q9NWB4
Gene ID:
Mouse(269152) kinesin family member 26B
Rat(305012) kinesin family member 26B
chicken(421490) kinesin family member 26B
chicken(100859813) kinesin family member 26B
dog(490379) kinesin family member 26B
cow(101902369) kinesin family member 26B
domestic cat(101090829) kinesin family member 26B
sheep(101106609) kinesin family member 26B
Domestic Rabbit(100349172) kinesin family member 26B
domestic guinea pig(100727516) kinesin family member 26B
naked mole-rat(101723848) kinesin family member 26B
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018012 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018012 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018012 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177757 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177757 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177757 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018012 Rosetta Predictions human pricing
XM_371354 Rosetta Predictions human pricing
XM_001061158 Rosetta Predictions rat pricing
XM_222971 Rosetta Predictions rat pricing
NM_177757 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018012 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351102 predicted 2062
2 SASI_Hs02_00351103 predicted 1221
3 SASI_Hs02_00351104 predicted 6593
4 SASI_Hs02_00351105 predicted 1612
5 SASI_Hs02_00351106 predicted 3267
6 SASI_Hs02_00351107 predicted 4479
7 SASI_Hs02_00351108 predicted 4595
8 SASI_Hs02_00351109 predicted 2102
9 SASI_Hs02_00351110 predicted 3852
10 SASI_Hs02_00351111 predicted 6390
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295467 predicted 579
2 SASI_Hs01_00295468 predicted 5109
3 SASI_Hs01_00295469 predicted 2999
4 SASI_Hs01_00295470 predicted 3110
5 SASI_Hs01_00295471 predicted 622
6 SASI_Hs01_00295472 predicted 2374
7 SASI_Hs01_00295473 predicted 4915
8 SASI_Hs01_00295474 predicted 650
9 SASI_Hs01_00295475 predicted 1585
10 SASI_Hs01_00295476 predicted 2215
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298942 predicted 1394
2 SASI_Rn02_00298943 predicted 5020
3 SASI_Rn02_00298944 predicted 1824
4 SASI_Rn02_00298945 predicted 707
5 SASI_Rn02_00298946 predicted 5204
6 SASI_Rn02_00298947 predicted 702
7 SASI_Rn02_00298948 predicted 4887
8 SASI_Rn02_00298949 predicted 3328
9 SASI_Rn02_00298950 predicted 2217
10 SASI_Rn02_00298951 predicted 3399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222971 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381023 predicted 1397
2 SASI_Rn02_00381024 predicted 5015
3 SASI_Rn02_00381025 predicted 1823
4 SASI_Rn02_00381026 predicted 709
5 SASI_Rn02_00381027 predicted 700
6 SASI_Rn02_00381028 predicted 4882
7 SASI_Rn02_00381029 predicted 3333
8 SASI_Rn02_00381030 predicted 2215
9 SASI_Rn02_00381031 predicted 3398
10 SASI_Rn02_00381032 predicted 3782
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177757 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182871 predicted 4557
2 SASI_Mm01_00182872 predicted 2015
3 SASI_Mm01_00182874 predicted 1340
4 SASI_Mm01_00182875 predicted 1276
5 SASI_Mm01_00182876 predicted 2568
6 SASI_Mm01_00182877 predicted 3426
7 SASI_Mm01_00182878 predicted 4686
8 SASI_Mm02_00348133 predicted 215
9 SASI_Mm01_00182879 predicted 1113
10 SASI_Mm02_00348134 predicted 3255
11 SASI_Mm01_00182873 predicted 253
12 SASI_Mm01_00182880 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018012
KIF26B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 26B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-919s21c1
Sequence:CCGGCGGCTGTGATTCACGACAAACCTCGAGGTTTGTCGTGAATCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-1336s21c1
Sequence:CCGGGCAATGGGAACATCCTCAATTCTCGAGAATTGAGGATGTTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-1604s21c1
Sequence:CCGGACGAGCTGCCCAGAAGTTAAACTCGAGTTTAACTTCTGGGCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018012.3-7020s21c1
Sequence:CCGGAGCACTTTGAGGAACCTTAAACTCGAGTTTAAGGTTCCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-2656s21c1
Sequence:CCGGTCATCCTGGCTCTCGTCAATGCTCGAGCATTGACGAGAGCCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018012
KIF26B MISSION shRNA shRNA Plasmid DNA
kinesin family member 26B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-919s21c1
Sequence:CCGGCGGCTGTGATTCACGACAAACCTCGAGGTTTGTCGTGAATCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-1336s21c1
Sequence:CCGGGCAATGGGAACATCCTCAATTCTCGAGAATTGAGGATGTTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-1604s21c1
Sequence:CCGGACGAGCTGCCCAGAAGTTAAACTCGAGTTTAACTTCTGGGCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018012.3-7020s21c1
Sequence:CCGGAGCACTTTGAGGAACCTTAAACTCGAGTTTAAGGTTCCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-2656s21c1
Sequence:CCGGTCATCCTGGCTCTCGTCAATGCTCGAGCATTGACGAGAGCCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018012
KIF26B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 26B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-919s21c1
Sequence:CCGGCGGCTGTGATTCACGACAAACCTCGAGGTTTGTCGTGAATCACAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-1336s21c1
Sequence:CCGGGCAATGGGAACATCCTCAATTCTCGAGAATTGAGGATGTTCCCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-1604s21c1
Sequence:CCGGACGAGCTGCCCAGAAGTTAAACTCGAGTTTAACTTCTGGGCAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018012.3-7020s21c1
Sequence:CCGGAGCACTTTGAGGAACCTTAAACTCGAGTTTAAGGTTCCTCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018012.3-2656s21c1
Sequence:CCGGTCATCCTGGCTCTCGTCAATGCTCGAGCATTGACGAGAGCCAGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177757
VALIDATED
KIF26B MISSION shRNA Bacterial Glycerol Stock
kinesin family member 26B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-5271s1c1
Sequence:CCGGCCAAACATTGTGTCCGTACTTCTCGAGAAGTACGGACACAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-2842s1c1
Sequence:CCGGCCTTGGCTTAAACGAGAAGAACTCGAGTTCTTCTCGTTTAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-3543s1c1
Sequence:CCGGCCACTACGAATGCTTGTCGTTCTCGAGAACGACAAGCATTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-1754s1c1
Sequence:CCGGCAGAGTACAAACCTCCCAGTTCTCGAGAACTGGGAGGTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-2541s1c1
Sequence:CCGGCCTGCTCATCTTATCTGAGATCTCGAGATCTCAGATAAGATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177757
VALIDATED
KIF26B MISSION shRNA shRNA Plasmid DNA
kinesin family member 26B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-5271s1c1
Sequence:CCGGCCAAACATTGTGTCCGTACTTCTCGAGAAGTACGGACACAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-2842s1c1
Sequence:CCGGCCTTGGCTTAAACGAGAAGAACTCGAGTTCTTCTCGTTTAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-3543s1c1
Sequence:CCGGCCACTACGAATGCTTGTCGTTCTCGAGAACGACAAGCATTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-1754s1c1
Sequence:CCGGCAGAGTACAAACCTCCCAGTTCTCGAGAACTGGGAGGTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-2541s1c1
Sequence:CCGGCCTGCTCATCTTATCTGAGATCTCGAGATCTCAGATAAGATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177757
VALIDATED
KIF26B MISSION shRNA Lentiviral Transduction Particles
kinesin family member 26B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-5271s1c1
Sequence:CCGGCCAAACATTGTGTCCGTACTTCTCGAGAAGTACGGACACAATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-2842s1c1
Sequence:CCGGCCTTGGCTTAAACGAGAAGAACTCGAGTTCTTCTCGTTTAAGCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-3543s1c1
Sequence:CCGGCCACTACGAATGCTTGTCGTTCTCGAGAACGACAAGCATTCGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-1754s1c1
Sequence:CCGGCAGAGTACAAACCTCCCAGTTCTCGAGAACTGGGAGGTTTGTACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177757.3-2541s1c1
Sequence:CCGGCCTGCTCATCTTATCTGAGATCTCGAGATCTCAGATAAGATGAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks