EMAIL THIS PAGE TO A FRIEND

KIF6

kinesin family member 6

Synonyms: C6orf102 dJ1043E3.1 dJ137F1.4 dJ188D3.1
Gene ID:
Mouse(319991) kinesin family member 6
Rat(171291) kinesin family member 6
sheep(101106209) kinesin family member 6
domestic guinea pig(100722369) kinesin family member 6
naked mole-rat(101726252) kinesin family member 6
Zebrafish(553436) kinesin family member 6
cow(100139627) kinesin family member 6
Horse(100147665) kinesin family member 6
domestic cat(101096233) kinesin family member 6
dog(481782) kinesin family member 6
chicken(428572) kinesin family member 6
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177052 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177052 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177052 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145027 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145027 Rosetta Predictions human pricing
XM_001062736 Rosetta Predictions rat pricing
XM_343524 Rosetta Predictions rat pricing
NM_177052 Rosetta Predictions mouse pricing
XM_001001635 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240122 predicted 323
2 SASI_Hs01_00240123 predicted 1069
3 SASI_Hs01_00240124 predicted 936
4 SASI_Hs01_00240125 predicted 211
5 SASI_Hs01_00240126 predicted 1916
6 SASI_Hs01_00240128 predicted 1210
7 SASI_Hs01_00240129 predicted 901
8 SASI_Hs02_00364890 predicted 1071
9 SASI_Hs01_00240131 predicted 885
10 SASI_Hs02_00364891 predicted 586
11 SASI_Hs01_00240127 predicted 2554
12 SASI_Hs01_00240130 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304443 predicted 937
2 SASI_Rn02_00304444 predicted 1116
3 SASI_Rn02_00304445 predicted 2201
4 SASI_Rn02_00304446 predicted 1035
5 SASI_Rn02_00304447 predicted 1704
6 SASI_Rn02_00304448 predicted 2343
7 SASI_Rn02_00304449 predicted 1053
8 SASI_Rn02_00304450 predicted 309
9 SASI_Rn02_00304451 predicted 467
10 SASI_Rn02_00304452 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395988 predicted 1830
2 SASI_Rn02_00395989 predicted 1902
3 SASI_Rn02_00395990 predicted 1899
4 SASI_Rn02_00395991 predicted 1830
5 SASI_Rn02_00395992 predicted 1751
6 SASI_Rn02_00395993 predicted 1796
7 SASI_Rn02_00395994 predicted 1770
8 SASI_Rn02_00395995 predicted 1890
9 SASI_Rn02_00395996 predicted 1776
10 SASI_Rn02_00395997 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347007 predicted 1425
2 SASI_Mm02_00347008 predicted 303
3 SASI_Mm02_00347009 predicted 940
4 SASI_Mm02_00347010 predicted 1557
5 SASI_Mm02_00347011 predicted 1700
6 SASI_Mm02_00347012 predicted 593
7 SASI_Mm02_00347013 predicted 2511
8 SASI_Mm02_00347014 predicted 1833
9 SASI_Mm02_00347015 predicted 1473
10 SASI_Mm02_00347016 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229685 predicted 2192
2 SASI_Mm01_00229686 predicted 2153
3 SASI_Mm01_00229687 predicted 2258
4 SASI_Mm01_00229688 predicted 2324
5 SASI_Mm01_00229689 predicted 2268
6 SASI_Mm01_00229690 predicted 2197
7 SASI_Mm01_00229691 predicted 2259
8 SASI_Mm01_00229692 predicted 2251
9 SASI_Mm01_00229693 predicted 2253
10 SASI_Mm01_00229694 predicted 2150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177052
KIF6 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-1300s1c1
Sequence:CCGGGCATCCTATTTGGAAGACCAACTCGAGTTGGTCTTCCAAATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-1080s1c1
Sequence:CCGGGAGGAACATTGATGAGTCTATCTCGAGATAGACTCATCAATGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-163s1c1
Sequence:CCGGCAAGGGATTTACTCCATAGATCTCGAGATCTATGGAGTAAATCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-519s1c1
Sequence:CCGGCACGACACACATTTCTTACTTCTCGAGAAGTAAGAAATGTGTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-231s1c1
Sequence:CCGGCCTGGCAGATGGATTCGTAAACTCGAGTTTACGAATCCATCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177052
KIF6 MISSION shRNA shRNA Plasmid DNA
kinesin family member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-1300s1c1
Sequence:CCGGGCATCCTATTTGGAAGACCAACTCGAGTTGGTCTTCCAAATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-1080s1c1
Sequence:CCGGGAGGAACATTGATGAGTCTATCTCGAGATAGACTCATCAATGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-163s1c1
Sequence:CCGGCAAGGGATTTACTCCATAGATCTCGAGATCTATGGAGTAAATCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-519s1c1
Sequence:CCGGCACGACACACATTTCTTACTTCTCGAGAAGTAAGAAATGTGTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-231s1c1
Sequence:CCGGCCTGGCAGATGGATTCGTAAACTCGAGTTTACGAATCCATCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177052
KIF6 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-1300s1c1
Sequence:CCGGGCATCCTATTTGGAAGACCAACTCGAGTTGGTCTTCCAAATAGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-1080s1c1
Sequence:CCGGGAGGAACATTGATGAGTCTATCTCGAGATAGACTCATCAATGTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-163s1c1
Sequence:CCGGCAAGGGATTTACTCCATAGATCTCGAGATCTATGGAGTAAATCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-519s1c1
Sequence:CCGGCACGACACACATTTCTTACTTCTCGAGAAGTAAGAAATGTGTGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177052.2-231s1c1
Sequence:CCGGCCTGGCAGATGGATTCGTAAACTCGAGTTTACGAATCCATCTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145027
KIF6 MISSION shRNA Bacterial Glycerol Stock
kinesin family member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145027.3-2545s1c1
Sequence:CCGGCCAGGAAATATCCATCCATGACTCGAGTCATGGATGGATATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-195s1c1
Sequence:CCGGCCTAGCTTGGAAATCATCTTACTCGAGTAAGATGATTTCCAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-2324s1c1
Sequence:CCGGCTGTGATGTGAATGCCAGGAACTCGAGTTCCTGGCATTCACATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-2121s1c1
Sequence:CCGGGTGAAGCTACAGAAAGAGTTTCTCGAGAAACTCTTTCTGTAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-1514s1c1
Sequence:CCGGCGAAATCAATATCCTGGTCAACTCGAGTTGACCAGGATATTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-1074s21c1
Sequence:CCGGAGGAATCTTGATGAGTCTATACTCGAGTATAGACTCATCAAGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-893s21c1
Sequence:CCGGTCTAACAGAGGCCAAGTATATCTCGAGATATACTTGGCCTCTGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-1112s21c1
Sequence:CCGGACAGCGAGTGGCACTCATAAACTCGAGTTTATGAGTGCCACTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145027
KIF6 MISSION shRNA shRNA Plasmid DNA
kinesin family member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145027.3-2545s1c1
Sequence:CCGGCCAGGAAATATCCATCCATGACTCGAGTCATGGATGGATATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-195s1c1
Sequence:CCGGCCTAGCTTGGAAATCATCTTACTCGAGTAAGATGATTTCCAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-2324s1c1
Sequence:CCGGCTGTGATGTGAATGCCAGGAACTCGAGTTCCTGGCATTCACATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-2121s1c1
Sequence:CCGGGTGAAGCTACAGAAAGAGTTTCTCGAGAAACTCTTTCTGTAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-1514s1c1
Sequence:CCGGCGAAATCAATATCCTGGTCAACTCGAGTTGACCAGGATATTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-1074s21c1
Sequence:CCGGAGGAATCTTGATGAGTCTATACTCGAGTATAGACTCATCAAGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-893s21c1
Sequence:CCGGTCTAACAGAGGCCAAGTATATCTCGAGATATACTTGGCCTCTGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-1112s21c1
Sequence:CCGGACAGCGAGTGGCACTCATAAACTCGAGTTTATGAGTGCCACTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145027
KIF6 MISSION shRNA Lentiviral Transduction Particles
kinesin family member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145027.3-2545s1c1
Sequence:CCGGCCAGGAAATATCCATCCATGACTCGAGTCATGGATGGATATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-195s1c1
Sequence:CCGGCCTAGCTTGGAAATCATCTTACTCGAGTAAGATGATTTCCAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-2324s1c1
Sequence:CCGGCTGTGATGTGAATGCCAGGAACTCGAGTTCCTGGCATTCACATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-2121s1c1
Sequence:CCGGGTGAAGCTACAGAAAGAGTTTCTCGAGAAACTCTTTCTGTAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145027.3-1514s1c1
Sequence:CCGGCGAAATCAATATCCTGGTCAACTCGAGTTGACCAGGATATTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-1074s21c1
Sequence:CCGGAGGAATCTTGATGAGTCTATACTCGAGTATAGACTCATCAAGATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-893s21c1
Sequence:CCGGTCTAACAGAGGCCAAGTATATCTCGAGATATACTTGGCCTCTGTTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145027.4-1112s21c1
Sequence:CCGGACAGCGAGTGGCACTCATAAACTCGAGTTTATGAGTGCCACTCGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks