EMAIL THIS PAGE TO A FRIEND

KIFAP3

kinesin-associated protein 3

Synonyms: FLA3 KAP-1 KAP-3 KAP3 SMAP Smg-GDS dJ190I16.1
Gene ID:
Human(22920) Summary: The small G protein GDP dissociation stimulator (smg GDS) is a regulator protein having two activities on a group of small G proteins including the Rho and Rap1 family members and Ki-Ras; one is to stimulate their GDP/GTP exchange reactions, and the other is to inhibit their interactions with membranes. The protein encoded by this gene contains 9 'Armadillo' repeats and interacts with the smg GDS protein through these repeats. This protein, which is highly concentrated around the endoplasmic reticulum, is phosphorylated by v-src, and this phosphorylation reduces the affinity of the protein for smg GDS. It is thought that this protein serves as a linker between human chromosome-associated polypeptide (HCAP) and KIF3A/B, a kinesin superfamily protein in the nucleus, and that it plays a role in the interaction of chromosomes with an ATPase motor protein. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Mouse(16579) kinesin-associated protein 3
Rat(289168) kinesin-associated protein 3
chicken(424395) kinesin-associated protein 3
cow(518402) kinesin-associated protein 3
Horse(100059088) kinesin-associated protein 3
domestic cat(101084337) kinesin-associated protein 3
dog(100685317) kinesin-associated protein 3
domestic guinea pig(100718672) kinesin-associated protein 3
naked mole-rat(101721676) kinesin-associated protein 3
sheep(101102827) kinesin-associated protein 3
Domestic Rabbit(100345771) kinesin-associated protein 3
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014970 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010629 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010629 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010629 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158511 MISSION® esiRNA esiRNA human KIFAP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014970 Rosetta Predictions human pricing
NM_001105964 Rosetta Predictions rat pricing
NM_010629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041458 predicted 1737
2 SASI_Hs01_00041459 predicted 1098
3 SASI_Hs01_00041461 predicted 2739
4 SASI_Hs01_00041464 predicted 2001
5 SASI_Hs02_00346681 predicted 2462
6 SASI_Hs01_00041465 predicted 2431
7 SASI_Hs02_00346682 predicted 2612
8 SASI_Hs02_00346683 predicted 979
9 SASI_Hs01_00041466 predicted 1972
10 SASI_Hs02_00346684 predicted 823
11 SASI_Hs01_00041457 predicted 1166
12 SASI_Hs01_00041460 predicted 2093
13 SASI_Hs01_00041462 predicted 2231
14 SASI_Hs01_00041463 predicted 2037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214282 predicted 779
2 SASI_Rn02_00214283 predicted 2028
3 SASI_Rn02_00214284 predicted 1332
4 SASI_Rn02_00214285 predicted 919
5 SASI_Rn02_00214286 predicted 2172
6 SASI_Rn02_00214287 predicted 938
7 SASI_Rn02_00214288 predicted 1695
8 SASI_Rn02_00214289 predicted 2316
9 SASI_Rn02_00214290 predicted 1104
10 SASI_Rn02_00214291 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318972 predicted 1680
2 SASI_Mm01_00039505 predicted 1320
3 SASI_Mm01_00039506 predicted 2200
4 SASI_Mm01_00039507 predicted 1325
5 SASI_Mm02_00318973 predicted 945
6 SASI_Mm01_00039508 predicted 1907
7 SASI_Mm01_00039510 predicted 2382
8 SASI_Mm02_00318974 predicted 1438
9 SASI_Mm01_00039511 predicted 2157
10 SASI_Mm01_00039512 predicted 1632
11 SASI_Mm01_00039509 predicted 2405
12 SASI_Mm01_00039513 predicted 922
13 SASI_Mm01_00039514 predicted 1678
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014970
KIFAP3 MISSION shRNA Bacterial Glycerol Stock
kinesin-associated protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014970.2-648s21c1
Sequence:CCGGTTGATGAAGTTGCTAACATTACTCGAGTAATGTTAGCAACTTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014970.2-905s21c1
Sequence:CCGGGGACTTATTACTCACTATAAACTCGAGTTTATAGTGAGTAATAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014970.2-2805s1c1
Sequence:CCGGCCCTCTGTCTTCTGTTAAGTACTCGAGTACTTAACAGAAGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-567s1c1
Sequence:CCGGGCCGTGATTCATTGTCAGGAACTCGAGTTCCTGACAATGAATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-1033s1c1
Sequence:CCGGCCAAACCTTGAGAAAGGATTACTCGAGTAATCCTTTCTCAAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-758s1c1
Sequence:CCGGCCTGATAACTTGGAAGAACTACTCGAGTAGTTCTTCCAAGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-2174s1c1
Sequence:CCGGCCAGCATATCTCATAGACCTACTCGAGTAGGTCTATGAGATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014970
KIFAP3 MISSION shRNA shRNA Plasmid DNA
kinesin-associated protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014970.2-648s21c1
Sequence:CCGGTTGATGAAGTTGCTAACATTACTCGAGTAATGTTAGCAACTTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014970.2-905s21c1
Sequence:CCGGGGACTTATTACTCACTATAAACTCGAGTTTATAGTGAGTAATAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014970.2-2805s1c1
Sequence:CCGGCCCTCTGTCTTCTGTTAAGTACTCGAGTACTTAACAGAAGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-567s1c1
Sequence:CCGGGCCGTGATTCATTGTCAGGAACTCGAGTTCCTGACAATGAATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-1033s1c1
Sequence:CCGGCCAAACCTTGAGAAAGGATTACTCGAGTAATCCTTTCTCAAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-758s1c1
Sequence:CCGGCCTGATAACTTGGAAGAACTACTCGAGTAGTTCTTCCAAGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-2174s1c1
Sequence:CCGGCCAGCATATCTCATAGACCTACTCGAGTAGGTCTATGAGATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014970
KIFAP3 MISSION shRNA Lentiviral Transduction Particles
kinesin-associated protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014970.2-648s21c1
Sequence:CCGGTTGATGAAGTTGCTAACATTACTCGAGTAATGTTAGCAACTTCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014970.2-905s21c1
Sequence:CCGGGGACTTATTACTCACTATAAACTCGAGTTTATAGTGAGTAATAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014970.2-2805s1c1
Sequence:CCGGCCCTCTGTCTTCTGTTAAGTACTCGAGTACTTAACAGAAGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-567s1c1
Sequence:CCGGGCCGTGATTCATTGTCAGGAACTCGAGTTCCTGACAATGAATCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-1033s1c1
Sequence:CCGGCCAAACCTTGAGAAAGGATTACTCGAGTAATCCTTTCTCAAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-758s1c1
Sequence:CCGGCCTGATAACTTGGAAGAACTACTCGAGTAGTTCTTCCAAGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014970.2-2174s1c1
Sequence:CCGGCCAGCATATCTCATAGACCTACTCGAGTAGGTCTATGAGATATGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010629
VALIDATED
KIFAP3 MISSION shRNA Bacterial Glycerol Stock
kinesin-associated protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-1913s21c1
Sequence:CCGGCGGTGTCTATGGATGACTCTTCTCGAGAAGAGTCATCCATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010629.2-3659s21c1
Sequence:CCGGCCCACTGATCTAAGTGTACTACTCGAGTAGTACACTTAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-1290s21c1
Sequence:CCGGGCTCCTCTTAAACCTCTCGTTCTCGAGAACGAGAGGTTTAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-931s21c1
Sequence:CCGGGCTGTTGATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-3660s1c1
Sequence:CCGGCCCACTGATCTAAGTGTACTACTCGAGTAGTACACTTAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-932s1c1
Sequence:CCGGGCTGTTGATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1914s1c1
Sequence:CCGGCGGTGTCTATGGATGACTCTTCTCGAGAAGAGTCATCCATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1291s1c1
Sequence:CCGGGCTCCTCTTAAACCTCTCGTTCTCGAGAACGAGAGGTTTAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1292s1c1
Sequence:CCGGCTCCTCTTAAACCTCTCGTTTCTCGAGAAACGAGAGGTTTAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010629
VALIDATED
KIFAP3 MISSION shRNA shRNA Plasmid DNA
kinesin-associated protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-1913s21c1
Sequence:CCGGCGGTGTCTATGGATGACTCTTCTCGAGAAGAGTCATCCATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010629.2-3659s21c1
Sequence:CCGGCCCACTGATCTAAGTGTACTACTCGAGTAGTACACTTAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-1290s21c1
Sequence:CCGGGCTCCTCTTAAACCTCTCGTTCTCGAGAACGAGAGGTTTAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-931s21c1
Sequence:CCGGGCTGTTGATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-3660s1c1
Sequence:CCGGCCCACTGATCTAAGTGTACTACTCGAGTAGTACACTTAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-932s1c1
Sequence:CCGGGCTGTTGATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1914s1c1
Sequence:CCGGCGGTGTCTATGGATGACTCTTCTCGAGAAGAGTCATCCATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1291s1c1
Sequence:CCGGGCTCCTCTTAAACCTCTCGTTCTCGAGAACGAGAGGTTTAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1292s1c1
Sequence:CCGGCTCCTCTTAAACCTCTCGTTTCTCGAGAAACGAGAGGTTTAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010629
VALIDATED
KIFAP3 MISSION shRNA Lentiviral Transduction Particles
kinesin-associated protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-1913s21c1
Sequence:CCGGCGGTGTCTATGGATGACTCTTCTCGAGAAGAGTCATCCATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309152    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010629.2-3659s21c1
Sequence:CCGGCCCACTGATCTAAGTGTACTACTCGAGTAGTACACTTAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-1290s21c1
Sequence:CCGGGCTCCTCTTAAACCTCTCGTTCTCGAGAACGAGAGGTTTAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010629.2-931s21c1
Sequence:CCGGGCTGTTGATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090943    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-3660s1c1
Sequence:CCGGCCCACTGATCTAAGTGTACTACTCGAGTAGTACACTTAGATCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-932s1c1
Sequence:CCGGGCTGTTGATGAAGACCTTGAACTCGAGTTCAAGGTCTTCATCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1914s1c1
Sequence:CCGGCGGTGTCTATGGATGACTCTTCTCGAGAAGAGTCATCCATAGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1291s1c1
Sequence:CCGGGCTCCTCTTAAACCTCTCGTTCTCGAGAACGAGAGGTTTAAGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010629.1-1292s1c1
Sequence:CCGGCTCCTCTTAAACCTCTCGTTTCTCGAGAAACGAGAGGTTTAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks