EMAIL THIS PAGE TO A FRIEND

KIR2DS5

killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5

Synonyms: CD158G NKAT9
Species: Human KIR2DS5(3810)
UniProtKB ID: Q14953
Gene ID:
Human(3810) Summary: Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several 'framework' genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. [provided by RefSeq, Jul 2008]
9 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014513 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014513 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108313 predicted 243
2 SASI_Hs01_00108315 predicted 243
3 SASI_Hs01_00108314 predicted 208
4 SASI_Hs01_00108316 predicted 269
5 SASI_Hs01_00108317 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014513
KIR2DS5 MISSION shRNA Bacterial Glycerol Stock
killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014513.2-1297s21c1
Sequence:CCGGTCCTTTGCTTAGCCCACAATTCTCGAGAATTGTGGGCTAAGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014513.2-234s21c1
Sequence:CCGGACCACACTTTGCGCCTCATTGCTCGAGCAATGAGGCGCAAAGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014513.2-1182s21c1
Sequence:CCGGAGGCATCAGTCTTCATCTTAGCTCGAGCTAAGATGAAGACTGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014513.2-777s21c1
Sequence:CCGGTTGGGACCTCAGTGGTCAAACCTCGAGGTTTGACCACTGAGGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-121s1c1
Sequence:CCGGCCCTGGTGAAATCAGAAGAGACTCGAGTCTCTTCTGATTTCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-789s1c1
Sequence:CCGGCTCCTCTTCTTTCTCCTTCATCTCGAGATGAAGGAGAAAGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-379s1c1
Sequence:CCGGCAGGTCTATATGAGAAACCTTCTCGAGAAGGTTTCTCATATAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-659s1c1
Sequence:CCGGGCTTGTTTCTGTCACAGGAAACTCGAGTTTCCTGTGACAGAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-533s1c1
Sequence:CCGGGCCCAAGGTCAACAGAACATTCTCGAGAATGTTCTGTTGACCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014513
KIR2DS5 MISSION shRNA shRNA Plasmid DNA
killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014513.2-1297s21c1
Sequence:CCGGTCCTTTGCTTAGCCCACAATTCTCGAGAATTGTGGGCTAAGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014513.2-234s21c1
Sequence:CCGGACCACACTTTGCGCCTCATTGCTCGAGCAATGAGGCGCAAAGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014513.2-1182s21c1
Sequence:CCGGAGGCATCAGTCTTCATCTTAGCTCGAGCTAAGATGAAGACTGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014513.2-777s21c1
Sequence:CCGGTTGGGACCTCAGTGGTCAAACCTCGAGGTTTGACCACTGAGGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-121s1c1
Sequence:CCGGCCCTGGTGAAATCAGAAGAGACTCGAGTCTCTTCTGATTTCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-789s1c1
Sequence:CCGGCTCCTCTTCTTTCTCCTTCATCTCGAGATGAAGGAGAAAGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-379s1c1
Sequence:CCGGCAGGTCTATATGAGAAACCTTCTCGAGAAGGTTTCTCATATAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-659s1c1
Sequence:CCGGGCTTGTTTCTGTCACAGGAAACTCGAGTTTCCTGTGACAGAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-533s1c1
Sequence:CCGGGCCCAAGGTCAACAGAACATTCTCGAGAATGTTCTGTTGACCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014513
KIR2DS5 MISSION shRNA Lentiviral Transduction Particles
killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014513.2-1297s21c1
Sequence:CCGGTCCTTTGCTTAGCCCACAATTCTCGAGAATTGTGGGCTAAGCAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014513.2-234s21c1
Sequence:CCGGACCACACTTTGCGCCTCATTGCTCGAGCAATGAGGCGCAAAGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014513.2-1182s21c1
Sequence:CCGGAGGCATCAGTCTTCATCTTAGCTCGAGCTAAGATGAAGACTGATGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014513.2-777s21c1
Sequence:CCGGTTGGGACCTCAGTGGTCAAACCTCGAGGTTTGACCACTGAGGTCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-121s1c1
Sequence:CCGGCCCTGGTGAAATCAGAAGAGACTCGAGTCTCTTCTGATTTCACCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-789s1c1
Sequence:CCGGCTCCTCTTCTTTCTCCTTCATCTCGAGATGAAGGAGAAAGAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-379s1c1
Sequence:CCGGCAGGTCTATATGAGAAACCTTCTCGAGAAGGTTTCTCATATAGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-659s1c1
Sequence:CCGGGCTTGTTTCTGTCACAGGAAACTCGAGTTTCCTGTGACAGAAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014513.1-533s1c1
Sequence:CCGGGCCCAAGGTCAACAGAACATTCTCGAGAATGTTCTGTTGACCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks