EMAIL THIS PAGE TO A FRIEND

KLC2

kinesin light chain 2

UniProtKB ID: Q9H0B6, A8MXL7, B2RDY4, Q9H9C8, Q9HA20
Gene ID:
Human(64837) Summary: Kinesin is a molecular motor that generates ATP-dependent movement of vesicles and organelles along microtubules. Kinesin consists of 2 light chains, such as KLC2, and 2 heavy chains (see KIF5B; MIM 602809) in a 1:1 stoichiometric ratio (Rahman et al., 1998 [PubMed 9624122]
Mouse(16594) kinesin light chain 2
Rat(309159) kinesin light chain 2
Zebrafish(562365) kinesin light chain 2
cow(518136) kinesin light chain 2
domestic cat(101082343) kinesin light chain 2
dog(483715) kinesin light chain 2
domestic guinea pig(100713189) kinesin light chain 2
naked mole-rat(101700298) kinesin light chain 2
sheep(101104701) kinesin light chain 2
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU064231 MISSION® esiRNA esiRNA targeting mouse Klc2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022822 Rosetta Predictions human pricing
NM_001107571 Rosetta Predictions rat pricing
NM_008451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00037219 predicted 370
2 SASI_Hs01_00037220 predicted 847
3 SASI_Hs01_00037221 predicted 2132
4 SASI_Hs01_00037222 predicted 1612
5 SASI_Hs02_00356124 predicted 2312
6 SASI_Hs01_00037224 predicted 2142
7 SASI_Hs01_00037225 predicted 2140
8 SASI_Hs01_00037226 predicted 1058
9 SASI_Hs01_00037227 predicted 2193
10 SASI_Hs01_00037228 predicted 1074
11 SASI_Hs01_00037223 predicted 1889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107571 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230145 predicted 483
2 SASI_Rn02_00230146 predicted 662
3 SASI_Rn02_00230147 predicted 320
4 SASI_Rn02_00230148 predicted 260
5 SASI_Rn02_00230149 predicted 478
6 SASI_Rn02_00230150 predicted 330
7 SASI_Rn02_00230151 predicted 290
8 SASI_Rn02_00230152 predicted 717
9 SASI_Rn02_00230153 predicted 327
10 SASI_Rn02_00230154 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074110 predicted 702
2 SASI_Mm01_00074111 predicted 1957
3 SASI_Mm01_00074112 predicted 2032
4 SASI_Mm01_00074113 predicted 1040
5 SASI_Mm01_00074114 predicted 1035
6 SASI_Mm01_00074115 predicted 1020
7 SASI_Mm02_00313947 predicted 335
8 SASI_Mm02_00313948 predicted 717
9 SASI_Mm01_00074116 predicted 1607
10 SASI_Mm01_00074117 predicted 1605
11 SASI_Mm01_00074118 predicted 1654
12 SASI_Mm01_00074119 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022822
VALIDATED
KLC2 MISSION shRNA Bacterial Glycerol Stock
kinesin light chain 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022822.2-2386s21c1
Sequence:CCGGCCCAGAGCCAAGAACACTAAGCTCGAGCTTAGTGTTCTTGGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022822.2-1054s21c1
Sequence:CCGGAGCCGTGGCTGCGACACTAAACTCGAGTTTAGTGTCGCAGCCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022822.1-2208s1c1
Sequence:CCGGCCTTATTTATTCCTTCCAGCACTCGAGTGCTGGAAGGAATAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-2197s1c1
Sequence:CCGGCCAGCTCCATCCCTTATTTATCTCGAGATAAATAAGGGATGGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-1883s1c1
Sequence:CCGGCAGTTCCCTCAACTTCCTCAACTCGAGTTGAGGAAGTTGAGGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022822.1-890s1c1
Sequence:CCGGCTATCGGGATCAGAACAAGTACTCGAGTACTTGTTCTGATCCCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022822.1-1326s1c1
Sequence:CCGGCGCGCTCATGAGAAAGAGTTTCTCGAGAAACTCTTTCTCATGAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-567s1c1
Sequence:CCGGCAGATCCGCAAGTTGGATGAACTCGAGTTCATCCAACTTGCGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022822
VALIDATED
KLC2 MISSION shRNA shRNA Plasmid DNA
kinesin light chain 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022822.2-2386s21c1
Sequence:CCGGCCCAGAGCCAAGAACACTAAGCTCGAGCTTAGTGTTCTTGGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022822.2-1054s21c1
Sequence:CCGGAGCCGTGGCTGCGACACTAAACTCGAGTTTAGTGTCGCAGCCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022822.1-2208s1c1
Sequence:CCGGCCTTATTTATTCCTTCCAGCACTCGAGTGCTGGAAGGAATAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-2197s1c1
Sequence:CCGGCCAGCTCCATCCCTTATTTATCTCGAGATAAATAAGGGATGGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-1883s1c1
Sequence:CCGGCAGTTCCCTCAACTTCCTCAACTCGAGTTGAGGAAGTTGAGGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022822.1-890s1c1
Sequence:CCGGCTATCGGGATCAGAACAAGTACTCGAGTACTTGTTCTGATCCCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022822.1-1326s1c1
Sequence:CCGGCGCGCTCATGAGAAAGAGTTTCTCGAGAAACTCTTTCTCATGAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-567s1c1
Sequence:CCGGCAGATCCGCAAGTTGGATGAACTCGAGTTCATCCAACTTGCGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022822
VALIDATED
KLC2 MISSION shRNA Lentiviral Transduction Particles
kinesin light chain 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022822.2-2386s21c1
Sequence:CCGGCCCAGAGCCAAGAACACTAAGCTCGAGCTTAGTGTTCTTGGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022822.2-1054s21c1
Sequence:CCGGAGCCGTGGCTGCGACACTAAACTCGAGTTTAGTGTCGCAGCCACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022822.1-2208s1c1
Sequence:CCGGCCTTATTTATTCCTTCCAGCACTCGAGTGCTGGAAGGAATAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179838    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-2197s1c1
Sequence:CCGGCCAGCTCCATCCCTTATTTATCTCGAGATAAATAAGGGATGGAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-1883s1c1
Sequence:CCGGCAGTTCCCTCAACTTCCTCAACTCGAGTTGAGGAAGTTGAGGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022822.1-890s1c1
Sequence:CCGGCTATCGGGATCAGAACAAGTACTCGAGTACTTGTTCTGATCCCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022822.1-1326s1c1
Sequence:CCGGCGCGCTCATGAGAAAGAGTTTCTCGAGAAACTCTTTCTCATGAGCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022822.1-567s1c1
Sequence:CCGGCAGATCCGCAAGTTGGATGAACTCGAGTTCATCCAACTTGCGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008451
VALIDATED
KLC2 MISSION shRNA Bacterial Glycerol Stock
kinesin light chain 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008451.2-2585s21c1
Sequence:CCGGCCTCTCTCTTATCCAGTGGTACTCGAGTACCACTGGATAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-1604s21c1
Sequence:CCGGAGCTGGTACAAAGCCTGTAAACTCGAGTTTACAGGCTTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-2028s21c1
Sequence:CCGGCCAGCTCTCTTAACTTCCTTACTCGAGTAAGGAAGTTAAGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-330s21c1
Sequence:CCGGAGCTGAGTCAGGACGAGATAGCTCGAGCTATCTCGTCCTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-706s21c1
Sequence:CCGGCCTGCTATTCATGAGTCAGATCTCGAGATCTGACTCATGAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-2405s1c1
Sequence:CCGGCCTCTCTCTTATCCAGTGGTACTCGAGTACCACTGGATAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-1852s1c1
Sequence:CCGGCCAGCTCTCTTAACTTCCTTACTCGAGTAAGGAAGTTAAGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-1853s1c1
Sequence:CCGGCAGCTCTCTTAACTTCCTTAACTCGAGTTAAGGAAGTTAAGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008451.1-1434s1c1
Sequence:CCGGAGCTGGTACAAAGCCTGTAAACTCGAGTTTACAGGCTTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-542s1c1
Sequence:CCGGCCTGCTATTCATGAGTCAGATCTCGAGATCTGACTCATGAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008451
VALIDATED
KLC2 MISSION shRNA shRNA Plasmid DNA
kinesin light chain 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008451.2-2585s21c1
Sequence:CCGGCCTCTCTCTTATCCAGTGGTACTCGAGTACCACTGGATAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-1604s21c1
Sequence:CCGGAGCTGGTACAAAGCCTGTAAACTCGAGTTTACAGGCTTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-2028s21c1
Sequence:CCGGCCAGCTCTCTTAACTTCCTTACTCGAGTAAGGAAGTTAAGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-330s21c1
Sequence:CCGGAGCTGAGTCAGGACGAGATAGCTCGAGCTATCTCGTCCTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-706s21c1
Sequence:CCGGCCTGCTATTCATGAGTCAGATCTCGAGATCTGACTCATGAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-2405s1c1
Sequence:CCGGCCTCTCTCTTATCCAGTGGTACTCGAGTACCACTGGATAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-1852s1c1
Sequence:CCGGCCAGCTCTCTTAACTTCCTTACTCGAGTAAGGAAGTTAAGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-1853s1c1
Sequence:CCGGCAGCTCTCTTAACTTCCTTAACTCGAGTTAAGGAAGTTAAGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008451.1-1434s1c1
Sequence:CCGGAGCTGGTACAAAGCCTGTAAACTCGAGTTTACAGGCTTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-542s1c1
Sequence:CCGGCCTGCTATTCATGAGTCAGATCTCGAGATCTGACTCATGAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008451
VALIDATED
KLC2 MISSION shRNA Lentiviral Transduction Particles
kinesin light chain 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008451.2-2585s21c1
Sequence:CCGGCCTCTCTCTTATCCAGTGGTACTCGAGTACCACTGGATAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-1604s21c1
Sequence:CCGGAGCTGGTACAAAGCCTGTAAACTCGAGTTTACAGGCTTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-2028s21c1
Sequence:CCGGCCAGCTCTCTTAACTTCCTTACTCGAGTAAGGAAGTTAAGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-330s21c1
Sequence:CCGGAGCTGAGTCAGGACGAGATAGCTCGAGCTATCTCGTCCTGACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008451.2-706s21c1
Sequence:CCGGCCTGCTATTCATGAGTCAGATCTCGAGATCTGACTCATGAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-2405s1c1
Sequence:CCGGCCTCTCTCTTATCCAGTGGTACTCGAGTACCACTGGATAAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-1852s1c1
Sequence:CCGGCCAGCTCTCTTAACTTCCTTACTCGAGTAAGGAAGTTAAGAGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-1853s1c1
Sequence:CCGGCAGCTCTCTTAACTTCCTTAACTCGAGTTAAGGAAGTTAAGAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008451.1-1434s1c1
Sequence:CCGGAGCTGGTACAAAGCCTGTAAACTCGAGTTTACAGGCTTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008451.1-542s1c1
Sequence:CCGGCCTGCTATTCATGAGTCAGATCTCGAGATCTGACTCATGAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks