EMAIL THIS PAGE TO A FRIEND

KLC4

kinesin light chain 4

Synonyms: KNSL8 bA387M24.3
UniProtKB ID: Q9NSK0, B3KNY4, B3KPI3, B3KSQ3, Q66K28, Q96EG6
Gene ID:
Mouse(74764) kinesin light chain 4
Rat(316226) kinesin light chain 4
Zebrafish(550511) kinesin light chain 4
chicken(769965) kinesin light chain 4
domestic cat(101084963) kinesin light chain 4
cow(767885) kinesin light chain 4
Horse(100055017) kinesin light chain 4
dog(474909) kinesin light chain 4
domestic guinea pig(100716559) kinesin light chain 4
naked mole-rat(101720397) kinesin light chain 4
sheep(101113441) kinesin light chain 4
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029091 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029091 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029091 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138343 Rosetta Predictions human pricing
NM_201521 Rosetta Predictions human pricing
NM_201522 Rosetta Predictions human pricing
NM_201523 Rosetta Predictions human pricing
NM_001009601 Rosetta Predictions rat pricing
NM_029091 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117085 predicted 535
2 SASI_Hs01_00117086 predicted 275
3 SASI_Hs02_00363432 predicted 547
4 SASI_Hs01_00117088 predicted 460
5 SASI_Hs01_00117089 predicted 687
6 SASI_Hs01_00117090 predicted 704
7 SASI_Hs01_00117091 predicted 406
8 SASI_Hs01_00117092 predicted 697
9 SASI_Hs01_00117093 predicted 666
10 SASI_Hs01_00117094 predicted 600
11 SASI_Hs01_00117087 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059456 predicted 529
2 SASI_Hs01_00059457 predicted 275
3 SASI_Hs02_00372998 predicted 546
4 SASI_Hs01_00059459 predicted 459
5 SASI_Hs01_00059460 predicted 680
6 SASI_Hs01_00059461 predicted 710
7 SASI_Hs01_00059462 predicted 407
8 SASI_Hs01_00059463 predicted 698
9 SASI_Hs01_00059464 predicted 670
10 SASI_Hs01_00059465 predicted 596
11 SASI_Hs01_00059458 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206254 predicted 647
2 SASI_Hs01_00206255 predicted 387
3 SASI_Hs02_00372999 predicted 660
4 SASI_Hs01_00206257 predicted 569
5 SASI_Hs01_00206258 predicted 789
6 SASI_Hs01_00206259 predicted 819
7 SASI_Hs01_00206260 predicted 517
8 SASI_Hs01_00206261 predicted 799
9 SASI_Hs01_00206262 predicted 781
10 SASI_Hs01_00206263 predicted 706
11 SASI_Hs01_00206256 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201523 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221372 predicted 834
2 SASI_Hs01_00221373 predicted 575
3 SASI_Hs02_00373000 predicted 841
4 SASI_Hs01_00221375 predicted 752
5 SASI_Hs01_00221376 predicted 977
6 SASI_Hs01_00221377 predicted 1008
7 SASI_Hs01_00221378 predicted 695
8 SASI_Hs01_00221379 predicted 989
9 SASI_Hs01_00221380 predicted 965
10 SASI_Hs01_00221381 predicted 890
11 SASI_Hs01_00221374 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009601 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088947 predicted 1482
2 SASI_Rn01_00088948 predicted 1433
3 SASI_Rn01_00088949 predicted 1652
4 SASI_Rn02_00199611 predicted 2063
5 SASI_Rn01_00088951 predicted 2202
6 SASI_Rn01_00088952 predicted 522
7 SASI_Rn01_00088953 predicted 1207
8 SASI_Rn01_00088954 predicted 1380
9 SASI_Rn01_00088955 predicted 1889
10 SASI_Rn01_00088956 predicted 1333
11 SASI_Rn01_00088950 predicted 987
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029091 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165664 predicted 1191
2 SASI_Mm01_00165665 predicted 1189
3 SASI_Mm02_00334857 predicted 1842
4 SASI_Mm01_00165667 predicted 1996
5 SASI_Mm01_00165668 predicted 1403
6 SASI_Mm01_00165669 predicted 1902
7 SASI_Mm01_00165670 predicted 1080
8 SASI_Mm01_00165671 predicted 1089
9 SASI_Mm01_00165672 predicted 1133
10 SASI_Mm01_00165673 predicted 1642
11 SASI_Mm01_00165666 predicted 1126
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029091
VALIDATED
KLC4 MISSION shRNA Bacterial Glycerol Stock
kinesin light chain 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1202s21c1
Sequence:CCGGGTAGCTCGGACCAAGAATAACCTCGAGGTTATTCTTGGTCCGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1264s21c1
Sequence:CCGGCGAGGCTCTGTACAAAGAGATCTCGAGATCTCTTTGTACAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-982s21c1
Sequence:CCGGGTACGGCAAACGCGGTAAATACTCGAGTATTTACCGCGTTTGCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1843s21c1
Sequence:CCGGGAACTACTTAAACCAACCCAACTCGAGTTGGGTTGGTTTAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029091.2-1142s21c1
Sequence:CCGGCGCTATTATCAGCGGGCACTACTCGAGTAGTGCCCGCTGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029091.1-2005s1c1
Sequence:CCGGCCAACTCAATAGGATGGTGAACTCGAGTTCACCATCCTATTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1844s1c1
Sequence:CCGGGAACTACTTAAACCAACCCAACTCGAGTTGGGTTGGTTTAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1265s1c1
Sequence:CCGGCGAGGCTCTGTACAAAGAGATCTCGAGATCTCTTTGTACAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1143s1c1
Sequence:CCGGCGCTATTATCAGCGGGCACTACTCGAGTAGTGCCCGCTGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-579s1c1
Sequence:CCGGGCCACCAAAGATTCTCTGGATCTCGAGATCCAGAGAATCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029091
VALIDATED
KLC4 MISSION shRNA shRNA Plasmid DNA
kinesin light chain 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1202s21c1
Sequence:CCGGGTAGCTCGGACCAAGAATAACCTCGAGGTTATTCTTGGTCCGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1264s21c1
Sequence:CCGGCGAGGCTCTGTACAAAGAGATCTCGAGATCTCTTTGTACAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-982s21c1
Sequence:CCGGGTACGGCAAACGCGGTAAATACTCGAGTATTTACCGCGTTTGCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1843s21c1
Sequence:CCGGGAACTACTTAAACCAACCCAACTCGAGTTGGGTTGGTTTAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029091.2-1142s21c1
Sequence:CCGGCGCTATTATCAGCGGGCACTACTCGAGTAGTGCCCGCTGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029091.1-2005s1c1
Sequence:CCGGCCAACTCAATAGGATGGTGAACTCGAGTTCACCATCCTATTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1844s1c1
Sequence:CCGGGAACTACTTAAACCAACCCAACTCGAGTTGGGTTGGTTTAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1265s1c1
Sequence:CCGGCGAGGCTCTGTACAAAGAGATCTCGAGATCTCTTTGTACAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1143s1c1
Sequence:CCGGCGCTATTATCAGCGGGCACTACTCGAGTAGTGCCCGCTGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-579s1c1
Sequence:CCGGGCCACCAAAGATTCTCTGGATCTCGAGATCCAGAGAATCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029091
VALIDATED
KLC4 MISSION shRNA Lentiviral Transduction Particles
kinesin light chain 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1202s21c1
Sequence:CCGGGTAGCTCGGACCAAGAATAACCTCGAGGTTATTCTTGGTCCGAGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1264s21c1
Sequence:CCGGCGAGGCTCTGTACAAAGAGATCTCGAGATCTCTTTGTACAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-982s21c1
Sequence:CCGGGTACGGCAAACGCGGTAAATACTCGAGTATTTACCGCGTTTGCCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029091.2-1843s21c1
Sequence:CCGGGAACTACTTAAACCAACCCAACTCGAGTTGGGTTGGTTTAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029091.2-1142s21c1
Sequence:CCGGCGCTATTATCAGCGGGCACTACTCGAGTAGTGCCCGCTGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029091.1-2005s1c1
Sequence:CCGGCCAACTCAATAGGATGGTGAACTCGAGTTCACCATCCTATTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1844s1c1
Sequence:CCGGGAACTACTTAAACCAACCCAACTCGAGTTGGGTTGGTTTAAGTAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1265s1c1
Sequence:CCGGCGAGGCTCTGTACAAAGAGATCTCGAGATCTCTTTGTACAGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-1143s1c1
Sequence:CCGGCGCTATTATCAGCGGGCACTACTCGAGTAGTGCCCGCTGATAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029091.1-579s1c1
Sequence:CCGGGCCACCAAAGATTCTCTGGATCTCGAGATCCAGAGAATCTTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138343
VALIDATED
KLC4 MISSION shRNA Bacterial Glycerol Stock
kinesin light chain 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138343.2-865s21c1
Sequence:CCGGATCGTGACCAGAATAAGTATACTCGAGTATACTTATTCTGGTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138343.2-363s21c1
Sequence:CCGGAGCACAGTGGAGTCGGAGAAACTCGAGTTTCTCCGACTCCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138343.2-1100s21c1
Sequence:CCGGGCACTGTCCAGTGATCCTAATCTCGAGATTAGGATCACTGGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138343.2-945s21c1
Sequence:CCGGGACCATCCTGCTGTCAGTATTCTCGAGAATACTGACAGCAGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138343.2-595s21c1
Sequence:CCGGATTCCCTGGATGACCTCTTTCCTCGAGGAAAGAGGTCATCCAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138343.2-838s1c1
Sequence:CCGGCCATGCTCAACATCCTTGCTTCTCGAGAAGCAAGGATGTTGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138343.2-845s1c1
Sequence:CCGGCAACATCCTTGCTTTGGTGTACTCGAGTACACCAAAGCAAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138343
VALIDATED
KLC4 MISSION shRNA shRNA Plasmid DNA
kinesin light chain 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138343.2-865s21c1
Sequence:CCGGATCGTGACCAGAATAAGTATACTCGAGTATACTTATTCTGGTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138343.2-363s21c1
Sequence:CCGGAGCACAGTGGAGTCGGAGAAACTCGAGTTTCTCCGACTCCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138343.2-1100s21c1
Sequence:CCGGGCACTGTCCAGTGATCCTAATCTCGAGATTAGGATCACTGGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138343.2-945s21c1
Sequence:CCGGGACCATCCTGCTGTCAGTATTCTCGAGAATACTGACAGCAGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138343.2-595s21c1
Sequence:CCGGATTCCCTGGATGACCTCTTTCCTCGAGGAAAGAGGTCATCCAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138343.2-838s1c1
Sequence:CCGGCCATGCTCAACATCCTTGCTTCTCGAGAAGCAAGGATGTTGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138343.2-845s1c1
Sequence:CCGGCAACATCCTTGCTTTGGTGTACTCGAGTACACCAAAGCAAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138343
VALIDATED
KLC4 MISSION shRNA Lentiviral Transduction Particles
kinesin light chain 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138343.2-865s21c1
Sequence:CCGGATCGTGACCAGAATAAGTATACTCGAGTATACTTATTCTGGTCACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_138343.2-363s21c1
Sequence:CCGGAGCACAGTGGAGTCGGAGAAACTCGAGTTTCTCCGACTCCACTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138343.2-1100s21c1
Sequence:CCGGGCACTGTCCAGTGATCCTAATCTCGAGATTAGGATCACTGGACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138343.2-945s21c1
Sequence:CCGGGACCATCCTGCTGTCAGTATTCTCGAGAATACTGACAGCAGGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138343.2-595s21c1
Sequence:CCGGATTCCCTGGATGACCTCTTTCCTCGAGGAAAGAGGTCATCCAGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138343.2-838s1c1
Sequence:CCGGCCATGCTCAACATCCTTGCTTCTCGAGAAGCAAGGATGTTGAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148406    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138343.2-845s1c1
Sequence:CCGGCAACATCCTTGCTTTGGTGTACTCGAGTACACCAAAGCAAGGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks