EMAIL THIS PAGE TO A FRIEND

KLF6

Kruppel-like factor 6

Synonyms: BCD1 CBA1 COPEB CPBP GBF PAC1 ST12 ZF9
Gene ID:
Human(1316) Summary: This gene encodes a member of the Kruppel-like family of transcription factors. The zinc finger protein is a transcriptional activator, and functions as a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene, some of which are implicated in carcinogenesis. [provided by RefSeq, May 2009]
Mouse(23849) Kruppel-like factor 6
Rat(58954) Kruppel-like factor 6
chicken(420463) Kruppel-like factor 6
domestic cat(101096489) Kruppel-like factor 6
cow(505884) Kruppel-like factor 6
dog(487151) Kruppel-like factor 6
domestic guinea pig(100721289) Kruppel-like factor 6
naked mole-rat(101720234) Kruppel-like factor 6
sheep(101111475) Kruppel-like factor 6
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011803 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011803 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011803 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001300 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001300 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001300 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008490 Rosetta Predictions human pricing
NM_001300 Rosetta Predictions human pricing
NM_031642 Rosetta Predictions rat pricing
NM_011803 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076512 predicted 870
2 SASI_Hs01_00076513 predicted 513
3 SASI_Hs01_00076514 predicted 387
4 SASI_Hs01_00076515 predicted 355
5 SASI_Hs01_00076516 predicted 591
6 SASI_Hs01_00076517 predicted 979
7 SASI_Hs01_00076518 predicted 934
8 SASI_Hs01_00076519 predicted 478
9 SASI_Hs01_00076520 predicted 984
10 SASI_Hs01_00076521 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001300 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331568 predicted 465
2 SASI_Hs02_00331569 predicted 428
3 SASI_Hs02_00331570 predicted 1350
4 SASI_Hs01_00161116 predicted 505
5 SASI_Hs02_00331571 predicted 473
6 SASI_Hs01_00161119 predicted 585
7 SASI_Hs02_00331572 predicted 468
8 SASI_Hs02_00331573 predicted 856
9 SASI_Hs01_00161120 predicted 977
10 SASI_Hs02_00331574 predicted 1341
11 SASI_Hs01_00161115 predicted 872
12 SASI_Hs01_00161117 predicted 395
13 SASI_Hs01_00161118 predicted 352
14 SASI_Hs01_00161121 predicted 932
15 SASI_Hs01_00161122 predicted 482
16 SASI_Hs01_00161123 predicted 988
17 SASI_Hs01_00161124 predicted 409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082277 predicted 462
2 SASI_Rn01_00082278 predicted 562
3 SASI_Rn01_00082279 predicted 440
4 SASI_Rn01_00082280 predicted 429
5 SASI_Rn01_00082282 predicted 396
6 SASI_Rn01_00082283 predicted 586
7 SASI_Rn01_00082284 predicted 925
8 SASI_Rn01_00082285 predicted 1029
9 SASI_Rn01_00082286 predicted 209
10 SASI_Rn02_00264950 predicted 618
11 SASI_Rn01_00082281 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011803 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063408 predicted 792
2 SASI_Mm01_00063409 predicted 520
3 SASI_Mm02_00321485 predicted 653
4 SASI_Mm01_00063410 predicted 647
5 SASI_Mm01_00063411 predicted 624
6 SASI_Mm01_00063412 predicted 478
7 SASI_Mm01_00063413 predicted 649
8 SASI_Mm01_00063414 predicted 545
9 SASI_Mm01_00063415 predicted 589
10 SASI_Mm01_00063416 predicted 604
11 SASI_Mm01_00063417 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011803
VALIDATED
KLF6 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 6
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-1403s21c1
Sequence:CCGGTGGTTGTGTTGAGGATCTATTCTCGAGAATAGATCCTCAACACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011803.2-987s21c1
Sequence:CCGGTGATGAGTTGACCAGACACTTCTCGAGAAGTGTCTGGTCAACTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-1545s21c1
Sequence:CCGGTGAGTTGACCACCAATCATTTCTCGAGAAATGATTGGTGGTCAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-671s21c1
Sequence:CCGGATCTGAGTTCCTCCGTCATTTCTCGAGAAATGACGGAGGAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011803.2-644s21c1
Sequence:CCGGTTGGTGAAGTCTTAGTCAATTCTCGAGAATTGACTAAGACTTCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-611s21c1
Sequence:GTACCGGTTTCACCCACGACCAAATTTACTCGAGTAAATTTGGTCGTGGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-525s21c1
Sequence:GTACCGGGATCAGCTCCAGCTTTAATTACTCGAGTAATTAAAGCTGGAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-3498s21c1
Sequence:CCGGCAGCGTAGACAGCTGATATTTCTCGAGAAATATCAGCTGTCTACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011803.1-580s1c1
Sequence:CCGGGATCCCATTGGTGAAGTCTTACTCGAGTAAGACTTCACCAATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011803.1-662s1c1
Sequence:CCGGACAGGGAATCTTCTCAACTATCTCGAGATAGTTGAGAAGATTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011803.1-930s1c1
Sequence:CCGGTGATGAGTTGACCAGACACTTCTCGAGAAGTGTCTGGTCAACTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011803.1-382s1c1
Sequence:CCGGCCGTGGACCAAATTCATTCTACTCGAGTAGAATGAATTTGGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011803.1-1175s1c1
Sequence:CCGGGCCTCTCTTTGGAAGGTCTTTCTCGAGAAAGACCTTCCAAAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011803
VALIDATED
KLF6 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 6
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-1403s21c1
Sequence:CCGGTGGTTGTGTTGAGGATCTATTCTCGAGAATAGATCCTCAACACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011803.2-987s21c1
Sequence:CCGGTGATGAGTTGACCAGACACTTCTCGAGAAGTGTCTGGTCAACTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-1545s21c1
Sequence:CCGGTGAGTTGACCACCAATCATTTCTCGAGAAATGATTGGTGGTCAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-671s21c1
Sequence:CCGGATCTGAGTTCCTCCGTCATTTCTCGAGAAATGACGGAGGAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011803.2-644s21c1
Sequence:CCGGTTGGTGAAGTCTTAGTCAATTCTCGAGAATTGACTAAGACTTCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-611s21c1
Sequence:GTACCGGTTTCACCCACGACCAAATTTACTCGAGTAAATTTGGTCGTGGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-525s21c1
Sequence:GTACCGGGATCAGCTCCAGCTTTAATTACTCGAGTAATTAAAGCTGGAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-3498s21c1
Sequence:CCGGCAGCGTAGACAGCTGATATTTCTCGAGAAATATCAGCTGTCTACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011803.1-580s1c1
Sequence:CCGGGATCCCATTGGTGAAGTCTTACTCGAGTAAGACTTCACCAATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011803.1-662s1c1
Sequence:CCGGACAGGGAATCTTCTCAACTATCTCGAGATAGTTGAGAAGATTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011803.1-930s1c1
Sequence:CCGGTGATGAGTTGACCAGACACTTCTCGAGAAGTGTCTGGTCAACTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011803.1-382s1c1
Sequence:CCGGCCGTGGACCAAATTCATTCTACTCGAGTAGAATGAATTTGGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011803.1-1175s1c1
Sequence:CCGGGCCTCTCTTTGGAAGGTCTTTCTCGAGAAAGACCTTCCAAAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011803
VALIDATED
KLF6 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 6
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-1403s21c1
Sequence:CCGGTGGTTGTGTTGAGGATCTATTCTCGAGAATAGATCCTCAACACAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011803.2-987s21c1
Sequence:CCGGTGATGAGTTGACCAGACACTTCTCGAGAAGTGTCTGGTCAACTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-1545s21c1
Sequence:CCGGTGAGTTGACCACCAATCATTTCTCGAGAAATGATTGGTGGTCAACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-671s21c1
Sequence:CCGGATCTGAGTTCCTCCGTCATTTCTCGAGAAATGACGGAGGAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011803.2-644s21c1
Sequence:CCGGTTGGTGAAGTCTTAGTCAATTCTCGAGAATTGACTAAGACTTCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-611s21c1
Sequence:GTACCGGTTTCACCCACGACCAAATTTACTCGAGTAAATTTGGTCGTGGGTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011803.2-525s21c1
Sequence:GTACCGGGATCAGCTCCAGCTTTAATTACTCGAGTAATTAAAGCTGGAGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011803.2-3498s21c1
Sequence:CCGGCAGCGTAGACAGCTGATATTTCTCGAGAAATATCAGCTGTCTACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011803.1-580s1c1
Sequence:CCGGGATCCCATTGGTGAAGTCTTACTCGAGTAAGACTTCACCAATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011803.1-662s1c1
Sequence:CCGGACAGGGAATCTTCTCAACTATCTCGAGATAGTTGAGAAGATTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011803.1-930s1c1
Sequence:CCGGTGATGAGTTGACCAGACACTTCTCGAGAAGTGTCTGGTCAACTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011803.1-382s1c1
Sequence:CCGGCCGTGGACCAAATTCATTCTACTCGAGTAGAATGAATTTGGTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011803.1-1175s1c1
Sequence:CCGGGCCTCTCTTTGGAAGGTCTTTCTCGAGAAAGACCTTCCAAAGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001300
KLF6 MISSION shRNA Bacterial Glycerol Stock
Kruppel-like factor 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-605s21c1
Sequence:CCGGTTTCTCCCACGGCCAAGTTTACTCGAGTAAACTTGGCCGTGGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-475s21c1
Sequence:GTACCGGGAATCCGAACTGAAGATATCTCTCGAGAGATATCTTCAGTTCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001300.4-1396s21c1
Sequence:CCGGATTGTATGTTGAGGATCTATTCTCGAGAATAGATCCTCAACATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-399s21c1
Sequence:CCGGTTCAGCCTCAGAAATCAAATTCTCGAGAATTTGATTTCTGAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-355s21c1
Sequence:CCGGTGCCTAGAGCTGGAACGTTACCTCGAGGTAACGTTCCAGCTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001300.3-1422s1c1
Sequence:CCGGCCGTATGATGAGGCCAACTTTCTCGAGAAAGTTGGCCTCATCATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-392s1c1
Sequence:CCGGGCTATGTTTCAGCCTCAGAAACTCGAGTTTCTGAGGCTGAAACATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-563s1c1
Sequence:CCGGACTCAGATGTCAGCAGCGAATCTCGAGATTCGCTGCTGACATCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-427s1c1
Sequence:CCGGCAGGAAGATCTGTGGACCAAACTCGAGTTTGGTCCACAGATCTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001300
KLF6 MISSION shRNA shRNA Plasmid DNA
Kruppel-like factor 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-605s21c1
Sequence:CCGGTTTCTCCCACGGCCAAGTTTACTCGAGTAAACTTGGCCGTGGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-475s21c1
Sequence:GTACCGGGAATCCGAACTGAAGATATCTCTCGAGAGATATCTTCAGTTCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001300.4-1396s21c1
Sequence:CCGGATTGTATGTTGAGGATCTATTCTCGAGAATAGATCCTCAACATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-399s21c1
Sequence:CCGGTTCAGCCTCAGAAATCAAATTCTCGAGAATTTGATTTCTGAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-355s21c1
Sequence:CCGGTGCCTAGAGCTGGAACGTTACCTCGAGGTAACGTTCCAGCTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001300.3-1422s1c1
Sequence:CCGGCCGTATGATGAGGCCAACTTTCTCGAGAAAGTTGGCCTCATCATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-392s1c1
Sequence:CCGGGCTATGTTTCAGCCTCAGAAACTCGAGTTTCTGAGGCTGAAACATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-563s1c1
Sequence:CCGGACTCAGATGTCAGCAGCGAATCTCGAGATTCGCTGCTGACATCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-427s1c1
Sequence:CCGGCAGGAAGATCTGTGGACCAAACTCGAGTTTGGTCCACAGATCTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001300
KLF6 MISSION shRNA Lentiviral Transduction Particles
Kruppel-like factor 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-605s21c1
Sequence:CCGGTTTCTCCCACGGCCAAGTTTACTCGAGTAAACTTGGCCGTGGGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-475s21c1
Sequence:GTACCGGGAATCCGAACTGAAGATATCTCTCGAGAGATATCTTCAGTTCGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001300.4-1396s21c1
Sequence:CCGGATTGTATGTTGAGGATCTATTCTCGAGAATAGATCCTCAACATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-399s21c1
Sequence:CCGGTTCAGCCTCAGAAATCAAATTCTCGAGAATTTGATTTCTGAGGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001300.4-355s21c1
Sequence:CCGGTGCCTAGAGCTGGAACGTTACCTCGAGGTAACGTTCCAGCTCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001300.3-1422s1c1
Sequence:CCGGCCGTATGATGAGGCCAACTTTCTCGAGAAAGTTGGCCTCATCATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-392s1c1
Sequence:CCGGGCTATGTTTCAGCCTCAGAAACTCGAGTTTCTGAGGCTGAAACATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-563s1c1
Sequence:CCGGACTCAGATGTCAGCAGCGAATCTCGAGATTCGCTGCTGACATCTGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001300.3-427s1c1
Sequence:CCGGCAGGAAGATCTGTGGACCAAACTCGAGTTTGGTCCACAGATCTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks