EMAIL THIS PAGE TO A FRIEND

KLHDC1

kelch domain containing 1

Synonyms: MST025
UniProtKB ID: Q8N7A1, B3KXD9, Q8WYI1
Gene ID:
Mouse(271005) kelch domain containing 1
Rat(314190) kelch domain containing 1
domestic guinea pig(100725582) kelch domain containing 1
naked mole-rat(101706520) kelch domain containing 1
sheep(101123469) kelch domain containing 1
chicken(423568) kelch domain containing 1
cow(537136) kelch domain containing 1
domestic cat(101093192) kelch domain containing 1
dog(490677) kelch domain containing 1
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172193 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172193 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172193 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172193 Rosetta Predictions human pricing
NM_001108027 Rosetta Predictions rat pricing
NM_178253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172193 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135499 predicted 275
2 SASI_Hs01_00135501 predicted 638
3 SASI_Hs01_00135502 predicted 298
4 SASI_Hs01_00135503 predicted 814
5 SASI_Hs01_00135505 predicted 529
6 SASI_Hs01_00135506 predicted 1232
7 SASI_Hs01_00135508 predicted 777
8 SASI_Hs02_00367886 predicted 822
9 SASI_Hs02_00367887 predicted 1170
10 SASI_Hs02_00367888 predicted 782
11 SASI_Hs01_00135500 predicted 1020
12 SASI_Hs01_00135504 predicted 1014
13 SASI_Hs01_00135507 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234645 predicted 766
2 SASI_Rn02_00234646 predicted 378
3 SASI_Rn02_00234647 predicted 1045
4 SASI_Rn02_00234648 predicted 503
5 SASI_Rn02_00234649 predicted 1109
6 SASI_Rn02_00234650 predicted 989
7 SASI_Rn02_00234651 predicted 910
8 SASI_Rn02_00234652 predicted 742
9 SASI_Rn02_00234653 predicted 428
10 SASI_Rn02_00234654 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064018 predicted 1068
2 SASI_Mm01_00064019 predicted 698
3 SASI_Mm01_00064020 predicted 744
4 SASI_Mm01_00064021 predicted 877
5 SASI_Mm01_00064022 predicted 1101
6 SASI_Mm01_00064023 predicted 907
7 SASI_Mm01_00064024 predicted 862
8 SASI_Mm01_00064025 predicted 354
9 SASI_Mm01_00064026 predicted 586
10 SASI_Mm01_00064027 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178253
KLHDC1 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.5-703s1c1
Sequence:CCGGGAAATAAGGGTTACGTCTTTGCTCGAGCAAAGACGTAACCCTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.5-749s1c1
Sequence:CCGGGAATGACCTACACTATCTAAACTCGAGTTTAGATAGTGTAGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178253.2-1585s1c1
Sequence:CCGGGAAAGACAGAAATAGCTCTAACTCGAGTTAGAGCTATTTCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-369s1c1
Sequence:CCGGCGGCTTTACTTTGTCAATTTACTCGAGTAAATTGACAAAGTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-176s1c1
Sequence:CCGGCTACGTGTCTATTGAAGACAACTCGAGTTGTCTTCAATAGACACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178253.2-1461s1c1
Sequence:CCGGCGATGTATCTGTGTGTTTGTTCTCGAGAACAAACACACAGATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-1062s1c1
Sequence:CCGGGATACAGGTCACTGTAATGATCTCGAGATCATTACAGTGACCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.2-943s1c1
Sequence:CCGGGTTGGAAACAACTTAGACATTCTCGAGAATGTCTAAGTTGTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178253.2-1620s1c1
Sequence:CCGGCTGTAATACAACTGTGGACATCTCGAGATGTCCACAGTTGTATTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178253
KLHDC1 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.5-703s1c1
Sequence:CCGGGAAATAAGGGTTACGTCTTTGCTCGAGCAAAGACGTAACCCTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.5-749s1c1
Sequence:CCGGGAATGACCTACACTATCTAAACTCGAGTTTAGATAGTGTAGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178253.2-1585s1c1
Sequence:CCGGGAAAGACAGAAATAGCTCTAACTCGAGTTAGAGCTATTTCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-369s1c1
Sequence:CCGGCGGCTTTACTTTGTCAATTTACTCGAGTAAATTGACAAAGTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-176s1c1
Sequence:CCGGCTACGTGTCTATTGAAGACAACTCGAGTTGTCTTCAATAGACACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178253.2-1461s1c1
Sequence:CCGGCGATGTATCTGTGTGTTTGTTCTCGAGAACAAACACACAGATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-1062s1c1
Sequence:CCGGGATACAGGTCACTGTAATGATCTCGAGATCATTACAGTGACCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.2-943s1c1
Sequence:CCGGGTTGGAAACAACTTAGACATTCTCGAGAATGTCTAAGTTGTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178253.2-1620s1c1
Sequence:CCGGCTGTAATACAACTGTGGACATCTCGAGATGTCCACAGTTGTATTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178253
KLHDC1 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216358    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.5-703s1c1
Sequence:CCGGGAAATAAGGGTTACGTCTTTGCTCGAGCAAAGACGTAACCCTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.5-749s1c1
Sequence:CCGGGAATGACCTACACTATCTAAACTCGAGTTTAGATAGTGTAGGTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178253.2-1585s1c1
Sequence:CCGGGAAAGACAGAAATAGCTCTAACTCGAGTTAGAGCTATTTCTGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-369s1c1
Sequence:CCGGCGGCTTTACTTTGTCAATTTACTCGAGTAAATTGACAAAGTAAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-176s1c1
Sequence:CCGGCTACGTGTCTATTGAAGACAACTCGAGTTGTCTTCAATAGACACGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176522    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178253.2-1461s1c1
Sequence:CCGGCGATGTATCTGTGTGTTTGTTCTCGAGAACAAACACACAGATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178253.2-1062s1c1
Sequence:CCGGGATACAGGTCACTGTAATGATCTCGAGATCATTACAGTGACCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178253.2-943s1c1
Sequence:CCGGGTTGGAAACAACTTAGACATTCTCGAGAATGTCTAAGTTGTTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178253.2-1620s1c1
Sequence:CCGGCTGTAATACAACTGTGGACATCTCGAGATGTCCACAGTTGTATTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172193
KLHDC1 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-282s1c1
Sequence:CCGGGAGGATATGATGACAAAGGATCTCGAGATCCTTTGTCATCATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1047s1c1
Sequence:CCGGCTTATTCACTACTCAGGTCATCTCGAGATGACCTGAGTAGTGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172193.1-1448s1c1
Sequence:CCGGCCTTACAAACTGCAGAACAAACTCGAGTTTGTTCTGCAGTTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1133s1c1
Sequence:CCGGCTTCTGCAACAAGTACTCAAACTCGAGTTTGAGTACTTGTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1000s1c1
Sequence:CCGGCTTGGATACAGGTCACTGTAACTCGAGTTACAGTGACCTGTATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1172s1c1
Sequence:CCGGGCAGCTAATCACCGAGAAGAACTCGAGTTCTTCTCGGTGATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172193
KLHDC1 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-282s1c1
Sequence:CCGGGAGGATATGATGACAAAGGATCTCGAGATCCTTTGTCATCATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1047s1c1
Sequence:CCGGCTTATTCACTACTCAGGTCATCTCGAGATGACCTGAGTAGTGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172193.1-1448s1c1
Sequence:CCGGCCTTACAAACTGCAGAACAAACTCGAGTTTGTTCTGCAGTTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1133s1c1
Sequence:CCGGCTTCTGCAACAAGTACTCAAACTCGAGTTTGAGTACTTGTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1000s1c1
Sequence:CCGGCTTGGATACAGGTCACTGTAACTCGAGTTACAGTGACCTGTATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1172s1c1
Sequence:CCGGGCAGCTAATCACCGAGAAGAACTCGAGTTCTTCTCGGTGATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172193
KLHDC1 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-282s1c1
Sequence:CCGGGAGGATATGATGACAAAGGATCTCGAGATCCTTTGTCATCATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1047s1c1
Sequence:CCGGCTTATTCACTACTCAGGTCATCTCGAGATGACCTGAGTAGTGAATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144247    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172193.1-1448s1c1
Sequence:CCGGCCTTACAAACTGCAGAACAAACTCGAGTTTGTTCTGCAGTTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1133s1c1
Sequence:CCGGCTTCTGCAACAAGTACTCAAACTCGAGTTTGAGTACTTGTTGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1000s1c1
Sequence:CCGGCTTGGATACAGGTCACTGTAACTCGAGTTACAGTGACCTGTATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172193.1-1172s1c1
Sequence:CCGGGCAGCTAATCACCGAGAAGAACTCGAGTTCTTCTCGGTGATTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks