EMAIL THIS PAGE TO A FRIEND

KLHDC4

kelch domain containing 4

UniProtKB ID: Q8TBB5, D3DUN3, D3DUN4, D3DUN5, Q96F29, Q9BVN3
Gene ID:
Mouse(234825) kelch domain containing 4
Rat(361426) kelch domain containing 4
domestic guinea pig(100730953) kelch domain containing 4
sheep(101105271) kelch domain containing 4
Domestic Rabbit(100352633) kelch domain containing 4
Zebrafish(569887) kelch domain containing 4
dog(489668) kelch domain containing 4
domestic cat(101096191) kelch domain containing 4
chicken(415831) kelch domain containing 4
cow(509550) kelch domain containing 4
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017566 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017566 Rosetta Predictions human pricing
XM_341704 Rosetta Predictions rat pricing
NM_145605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227449 predicted 950
2 SASI_Hs01_00227450 predicted 325
3 SASI_Hs01_00227451 predicted 284
4 SASI_Hs01_00227452 predicted 533
5 SASI_Hs01_00227453 predicted 245
6 SASI_Hs01_00227454 predicted 249
7 SASI_Hs01_00227455 predicted 459
8 SASI_Hs01_00227456 predicted 840
9 SASI_Hs01_00227457 predicted 881
10 SASI_Hs01_00227458 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00139092 predicted 532
2 SASI_Rn01_00139093 predicted 420
3 SASI_Rn01_00139094 predicted 533
4 SASI_Rn01_00139095 predicted 540
5 SASI_Rn01_00139096 predicted 482
6 SASI_Rn01_00139097 predicted 552
7 SASI_Rn01_00139098 predicted 425
8 SASI_Rn01_00139099 predicted 294
9 SASI_Rn01_00139100 predicted 487
10 SASI_Rn01_00139101 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341157 predicted 1798
2 SASI_Mm01_00109516 predicted 1576
3 SASI_Mm01_00109517 predicted 370
4 SASI_Mm01_00109518 predicted 686
5 SASI_Mm01_00109519 predicted 1419
6 SASI_Mm01_00109520 predicted 1835
7 SASI_Mm01_00109521 predicted 818
8 SASI_Mm01_00109522 predicted 997
9 SASI_Mm01_00109523 predicted 1805
10 SASI_Mm01_00109525 predicted 923
11 SASI_Mm01_00109524 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017566
VALIDATED
KLHDC4 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-654s21c1
Sequence:CCGGTCTACTACAACGACGTGTATGCTCGAGCATACACGTCGTTGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-154s21c1
Sequence:CCGGGGAAGCGCTCATAGCCCATTTCTCGAGAAATGGGCTATGAGCGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-330s21c1
Sequence:CCGGACGAGCTCTATGTCTACAATACTCGAGTATTGTAGACATAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-1668s21c1
Sequence:CCGGGCCGTGTTGAGTGAAGCTCTTCTCGAGAAGAGCTTCACTCAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-873s21c1
Sequence:CCGGGAAGAGAAGACAAGTGGGTTTCTCGAGAAACCCACTTGTCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017566.2-234s1c1
Sequence:CCGGCAAGGTTAAATGCCTCCCTCTCTCGAGAGAGGGAGGCATTTAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-601s1c1
Sequence:CCGGGAAGAGACAATTGATCCTGTTCTCGAGAACAGGATCAATTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-294s1c1
Sequence:CCGGGTGAATATTTCAACGGCCAAACTCGAGTTTGGCCGTTGAAATATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-361s1c1
Sequence:CCGGCACCTGGACCAAAGTTGACATCTCGAGATGTCAACTTTGGTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-106s1c1
Sequence:CCGGGATGGAGAAGAAGGTGTCTAACTCGAGTTAGACACCTTCTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-1024s1c1
Sequence:CCGGCGAGTTCTTCAACGATCTGTACTCGAGTACAGATCGTTGAAGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-1027s1c1
Sequence:CCGGGTTCTTCAACGATCTGTACTTCTCGAGAAGTACAGATCGTTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-873s1c1
Sequence:CCGGGAAGAGAAGACAAGTGGGTTTCTCGAGAAACCCACTTGTCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017566
VALIDATED
KLHDC4 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-654s21c1
Sequence:CCGGTCTACTACAACGACGTGTATGCTCGAGCATACACGTCGTTGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-154s21c1
Sequence:CCGGGGAAGCGCTCATAGCCCATTTCTCGAGAAATGGGCTATGAGCGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-330s21c1
Sequence:CCGGACGAGCTCTATGTCTACAATACTCGAGTATTGTAGACATAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-1668s21c1
Sequence:CCGGGCCGTGTTGAGTGAAGCTCTTCTCGAGAAGAGCTTCACTCAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-873s21c1
Sequence:CCGGGAAGAGAAGACAAGTGGGTTTCTCGAGAAACCCACTTGTCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017566.2-234s1c1
Sequence:CCGGCAAGGTTAAATGCCTCCCTCTCTCGAGAGAGGGAGGCATTTAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-601s1c1
Sequence:CCGGGAAGAGACAATTGATCCTGTTCTCGAGAACAGGATCAATTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-294s1c1
Sequence:CCGGGTGAATATTTCAACGGCCAAACTCGAGTTTGGCCGTTGAAATATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-361s1c1
Sequence:CCGGCACCTGGACCAAAGTTGACATCTCGAGATGTCAACTTTGGTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-106s1c1
Sequence:CCGGGATGGAGAAGAAGGTGTCTAACTCGAGTTAGACACCTTCTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-1024s1c1
Sequence:CCGGCGAGTTCTTCAACGATCTGTACTCGAGTACAGATCGTTGAAGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-1027s1c1
Sequence:CCGGGTTCTTCAACGATCTGTACTTCTCGAGAAGTACAGATCGTTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-873s1c1
Sequence:CCGGGAAGAGAAGACAAGTGGGTTTCTCGAGAAACCCACTTGTCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017566
VALIDATED
KLHDC4 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-654s21c1
Sequence:CCGGTCTACTACAACGACGTGTATGCTCGAGCATACACGTCGTTGTAGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-154s21c1
Sequence:CCGGGGAAGCGCTCATAGCCCATTTCTCGAGAAATGGGCTATGAGCGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-330s21c1
Sequence:CCGGACGAGCTCTATGTCTACAATACTCGAGTATTGTAGACATAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277698    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-1668s21c1
Sequence:CCGGGCCGTGTTGAGTGAAGCTCTTCTCGAGAAGAGCTTCACTCAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017566.2-873s21c1
Sequence:CCGGGAAGAGAAGACAAGTGGGTTTCTCGAGAAACCCACTTGTCTTCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017566.2-234s1c1
Sequence:CCGGCAAGGTTAAATGCCTCCCTCTCTCGAGAGAGGGAGGCATTTAACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-601s1c1
Sequence:CCGGGAAGAGACAATTGATCCTGTTCTCGAGAACAGGATCAATTGTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-294s1c1
Sequence:CCGGGTGAATATTTCAACGGCCAAACTCGAGTTTGGCCGTTGAAATATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-361s1c1
Sequence:CCGGCACCTGGACCAAAGTTGACATCTCGAGATGTCAACTTTGGTCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-106s1c1
Sequence:CCGGGATGGAGAAGAAGGTGTCTAACTCGAGTTAGACACCTTCTTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-1024s1c1
Sequence:CCGGCGAGTTCTTCAACGATCTGTACTCGAGTACAGATCGTTGAAGAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017566.2-1027s1c1
Sequence:CCGGGTTCTTCAACGATCTGTACTTCTCGAGAAGTACAGATCGTTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_017566.2-873s1c1
Sequence:CCGGGAAGAGAAGACAAGTGGGTTTCTCGAGAAACCCACTTGTCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145605
VALIDATED
KLHDC4 MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-690s21c1
Sequence:CCGGGACTACATCTACTACAGTGATCTCGAGATCACTGTAGTAGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1901s21c1
Sequence:CCGGGAGTGGTCTTCTGTGAGCCTTCTCGAGAAGGCTCACAGAAGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1423s21c1
Sequence:CCGGACGTCTATGGCGGCATGTTTGCTCGAGCAAACATGCCGCCATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1806s21c1
Sequence:CCGGGATGATGCAGTTCAAGACATTCTCGAGAATGTCTTGAACTGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-845s21c1
Sequence:CCGGGCAGAGAGTCAAGAAAGATGTCTCGAGACATCTTTCTTGACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145605.1-1849s1c1
Sequence:CCGGCGCAATGGTTTCACCATCACTCTCGAGAGTGATGGTGAAACCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145605.1-690s1c1
Sequence:CCGGGACTACATCTACTACAGTGATCTCGAGATCACTGTAGTAGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145605.1-845s1c1
Sequence:CCGGGCAGAGAGTCAAGAAAGATGTCTCGAGACATCTTTCTTGACTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145605.1-817s1c1
Sequence:CCGGGCATAGCCATCTATGGAGGTTCTCGAGAACCTCCATAGATGGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145605.1-1806s1c1
Sequence:CCGGGATGATGCAGTTCAAGACATTCTCGAGAATGTCTTGAACTGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145605
VALIDATED
KLHDC4 MISSION shRNA shRNA Plasmid DNA
kelch domain containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-690s21c1
Sequence:CCGGGACTACATCTACTACAGTGATCTCGAGATCACTGTAGTAGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1901s21c1
Sequence:CCGGGAGTGGTCTTCTGTGAGCCTTCTCGAGAAGGCTCACAGAAGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1423s21c1
Sequence:CCGGACGTCTATGGCGGCATGTTTGCTCGAGCAAACATGCCGCCATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1806s21c1
Sequence:CCGGGATGATGCAGTTCAAGACATTCTCGAGAATGTCTTGAACTGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-845s21c1
Sequence:CCGGGCAGAGAGTCAAGAAAGATGTCTCGAGACATCTTTCTTGACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145605.1-1849s1c1
Sequence:CCGGCGCAATGGTTTCACCATCACTCTCGAGAGTGATGGTGAAACCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145605.1-690s1c1
Sequence:CCGGGACTACATCTACTACAGTGATCTCGAGATCACTGTAGTAGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145605.1-845s1c1
Sequence:CCGGGCAGAGAGTCAAGAAAGATGTCTCGAGACATCTTTCTTGACTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145605.1-817s1c1
Sequence:CCGGGCATAGCCATCTATGGAGGTTCTCGAGAACCTCCATAGATGGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145605.1-1806s1c1
Sequence:CCGGGATGATGCAGTTCAAGACATTCTCGAGAATGTCTTGAACTGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145605
VALIDATED
KLHDC4 MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-690s21c1
Sequence:CCGGGACTACATCTACTACAGTGATCTCGAGATCACTGTAGTAGATGTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1901s21c1
Sequence:CCGGGAGTGGTCTTCTGTGAGCCTTCTCGAGAAGGCTCACAGAAGACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1423s21c1
Sequence:CCGGACGTCTATGGCGGCATGTTTGCTCGAGCAAACATGCCGCCATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-1806s21c1
Sequence:CCGGGATGATGCAGTTCAAGACATTCTCGAGAATGTCTTGAACTGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145605.1-845s21c1
Sequence:CCGGGCAGAGAGTCAAGAAAGATGTCTCGAGACATCTTTCTTGACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145605.1-1849s1c1
Sequence:CCGGCGCAATGGTTTCACCATCACTCTCGAGAGTGATGGTGAAACCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145605.1-690s1c1
Sequence:CCGGGACTACATCTACTACAGTGATCTCGAGATCACTGTAGTAGATGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145605.1-845s1c1
Sequence:CCGGGCAGAGAGTCAAGAAAGATGTCTCGAGACATCTTTCTTGACTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145605.1-817s1c1
Sequence:CCGGGCATAGCCATCTATGGAGGTTCTCGAGAACCTCCATAGATGGCTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145605.1-1806s1c1
Sequence:CCGGGATGATGCAGTTCAAGACATTCTCGAGAATGTCTTGAACTGCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks