EMAIL THIS PAGE TO A FRIEND

KLHDC8A

kelch domain containing 8A

UniProtKB ID: Q8IYD2, B3KU70, Q9NVG5
Gene ID:
Human(55220) Summary: This gene encodes a kelch domain-containing protein which is upregulated in cancer. Upregulated expression of the encoded protein may provide an alternative pathway for tumors to maintain aggressiveness in the absence of epidermal growth factor receptor dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(213417) kelch domain containing 8A
Rat(305096) kelch domain containing 8A
sheep(101110350) kelch domain containing 8A
Domestic Rabbit(100349092) kelch domain containing 8A
domestic guinea pig(100720269) kelch domain containing 8A
naked mole-rat(101708854) kelch domain containing 8A
chicken(419829) kelch domain containing 8A
domestic cat(101085016) kelch domain containing 8A
cow(532283) kelch domain containing 8A
Horse(100054942) kelch domain containing 8A
dog(488571) kelch domain containing 8A
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40902 Anti-KLHDC8A antibody produced in rabbit IgG fraction of antiserum guinea pig, human, canine, rat, bovine, rabbit, mouse, horse
western blot pricing
SAB2101281 Anti-KLHDC8A antibody produced in rabbit affinity isolated antibody canine, guinea pig, horse, rat, rabbit, bovine, human, mouse
western blot pricing
HPA030181 Anti-KLHDC8A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018203 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018203 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018203 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018203 Rosetta Predictions human pricing
XM_001059291 Rosetta Predictions rat pricing
XM_223109 Rosetta Predictions rat pricing
NM_144810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104920 predicted 1644
2 SASI_Hs01_00104921 predicted 1656
3 SASI_Hs02_00351491 predicted 919
4 SASI_Hs02_00351492 predicted 1649
5 SASI_Hs01_00104922 predicted 1333
6 SASI_Hs02_00351493 predicted 1641
7 SASI_Hs01_00104923 predicted 1845
8 SASI_Hs01_00104924 predicted 1801
9 SASI_Hs01_00104925 predicted 1671
10 SASI_Hs02_00351494 predicted 938
11 SASI_Hs01_00104918 predicted 1762
12 SASI_Hs01_00104919 predicted 985
13 SASI_Hs01_00104926 predicted 942
14 SASI_Hs01_00104927 predicted 1869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059291 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292717 predicted 800
2 SASI_Rn02_00292718 predicted 672
3 SASI_Rn02_00292719 predicted 1577
4 SASI_Rn02_00292720 predicted 1115
5 SASI_Rn02_00292721 predicted 946
6 SASI_Rn02_00292722 predicted 1101
7 SASI_Rn02_00292723 predicted 1591
8 SASI_Rn02_00292724 predicted 758
9 SASI_Rn02_00292725 predicted 933
10 SASI_Rn02_00292726 predicted 876
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381139 predicted 807
2 SASI_Rn02_00381140 predicted 671
3 SASI_Rn02_00381141 predicted 1571
4 SASI_Rn02_00381142 predicted 1114
5 SASI_Rn02_00381143 predicted 949
6 SASI_Rn02_00381144 predicted 1096
7 SASI_Rn02_00381145 predicted 1593
8 SASI_Rn02_00381146 predicted 756
9 SASI_Rn02_00381147 predicted 935
10 SASI_Rn02_00381148 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101806 predicted 1381
2 SASI_Mm01_00101807 predicted 1214
3 SASI_Mm01_00101808 predicted 1073
4 SASI_Mm01_00101809 predicted 935
5 SASI_Mm01_00101810 predicted 1362
6 SASI_Mm01_00101811 predicted 1022
7 SASI_Mm01_00101812 predicted 1207
8 SASI_Mm01_00101813 predicted 658
9 SASI_Mm01_00101814 predicted 915
10 SASI_Mm01_00101815 predicted 1754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144810
VALIDATED
KLHDC8A MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 8A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1222s1c1
Sequence:CCGGGCCTTCGAGGTCTTTGATATACTCGAGTATATCAAAGACCTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1021s1c1
Sequence:CCGGGCCAAAGATTATCGAGTGTATCTCGAGATACACTCGATAATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1086s1c1
Sequence:CCGGGCAACACTATGACATGCTGAACTCGAGTTCAGCATGTCATAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144810.2-915s1c1
Sequence:CCGGCACCAATCAACTGCCTGTGAACTCGAGTTCACAGGCAGTTGATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144810.2-1380s1c1
Sequence:CCGGGACAATGGATGTGTTCGACATCTCGAGATGTCGAACACATCCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144810.2-3602s1c1
Sequence:CCGGGCAGGTTCTATGAGGTTGAATCTCGAGATTCAACCTCATAGAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144810.2-2913s1c1
Sequence:CCGGCCAGTCATTCATATTGGATTACTCGAGTAATCCAATATGAATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-1306s21c1
Sequence:CCGGACCCTGGACAACCACTTATACCTCGAGGTATAAGTGGTTGTCCAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-1381s21c1
Sequence:CCGCACAATGGATGTGTTCGACATGCTCGAGCATGTCGAACACATCCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144810.5-2052s21c1
Sequence:CCGGTGTCGTGAGAGATAAACTAATCTCGAGATTAGTTTATCTCTCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-877s21c1
Sequence:CCGGGCCCTAGGAAAGCGGATTATGCTCGAGCATAATCCGCTTTCCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-786s21c1
Sequence:CCGGTATGGACTGCTTCGAGGTCTACTCGAGTAGACCTCGAAGCAGTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144810
VALIDATED
KLHDC8A MISSION shRNA shRNA Plasmid DNA
kelch domain containing 8A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1222s1c1
Sequence:CCGGGCCTTCGAGGTCTTTGATATACTCGAGTATATCAAAGACCTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1021s1c1
Sequence:CCGGGCCAAAGATTATCGAGTGTATCTCGAGATACACTCGATAATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1086s1c1
Sequence:CCGGGCAACACTATGACATGCTGAACTCGAGTTCAGCATGTCATAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144810.2-915s1c1
Sequence:CCGGCACCAATCAACTGCCTGTGAACTCGAGTTCACAGGCAGTTGATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144810.2-1380s1c1
Sequence:CCGGGACAATGGATGTGTTCGACATCTCGAGATGTCGAACACATCCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144810.2-3602s1c1
Sequence:CCGGGCAGGTTCTATGAGGTTGAATCTCGAGATTCAACCTCATAGAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144810.2-2913s1c1
Sequence:CCGGCCAGTCATTCATATTGGATTACTCGAGTAATCCAATATGAATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-1306s21c1
Sequence:CCGGACCCTGGACAACCACTTATACCTCGAGGTATAAGTGGTTGTCCAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-1381s21c1
Sequence:CCGCACAATGGATGTGTTCGACATGCTCGAGCATGTCGAACACATCCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144810.5-2052s21c1
Sequence:CCGGTGTCGTGAGAGATAAACTAATCTCGAGATTAGTTTATCTCTCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-877s21c1
Sequence:CCGGGCCCTAGGAAAGCGGATTATGCTCGAGCATAATCCGCTTTCCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-786s21c1
Sequence:CCGGTATGGACTGCTTCGAGGTCTACTCGAGTAGACCTCGAAGCAGTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144810
VALIDATED
KLHDC8A MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 8A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1222s1c1
Sequence:CCGGGCCTTCGAGGTCTTTGATATACTCGAGTATATCAAAGACCTCGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1021s1c1
Sequence:CCGGGCCAAAGATTATCGAGTGTATCTCGAGATACACTCGATAATCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_144810.2-1086s1c1
Sequence:CCGGGCAACACTATGACATGCTGAACTCGAGTTCAGCATGTCATAGTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144810.2-915s1c1
Sequence:CCGGCACCAATCAACTGCCTGTGAACTCGAGTTCACAGGCAGTTGATTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144810.2-1380s1c1
Sequence:CCGGGACAATGGATGTGTTCGACATCTCGAGATGTCGAACACATCCATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144810.2-3602s1c1
Sequence:CCGGGCAGGTTCTATGAGGTTGAATCTCGAGATTCAACCTCATAGAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193355    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144810.2-2913s1c1
Sequence:CCGGCCAGTCATTCATATTGGATTACTCGAGTAATCCAATATGAATGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-1306s21c1
Sequence:CCGGACCCTGGACAACCACTTATACCTCGAGGTATAAGTGGTTGTCCAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-1381s21c1
Sequence:CCGCACAATGGATGTGTTCGACATGCTCGAGCATGTCGAACACATCCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144810.5-2052s21c1
Sequence:CCGGTGTCGTGAGAGATAAACTAATCTCGAGATTAGTTTATCTCTCACGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-877s21c1
Sequence:CCGGGCCCTAGGAAAGCGGATTATGCTCGAGCATAATCCGCTTTCCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144810.5-786s21c1
Sequence:CCGGTATGGACTGCTTCGAGGTCTACTCGAGTAGACCTCGAAGCAGTCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018203
KLHDC8A MISSION shRNA Bacterial Glycerol Stock
kelch domain containing 8A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138761    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018203.1-1842s1c1
Sequence:CCGGGCTGACTCTGAAGAGAGTCTTCTCGAGAAGACTCTCTTCAGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018203.1-2134s1c1
Sequence:CCGGCCTCATCTACTCAGCGAGAATCTCGAGATTCTCGCTGAGTAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1180s1c1
Sequence:CCGGGTTTCCCAACATTCCCTATAACTCGAGTTATAGGGAATGTTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018203.1-2148s1c1
Sequence:CCGGCGAGAATTGGACATGAAGCTACTCGAGTAGCTTCATGTCCAATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-1003s1c1
Sequence:CCGGCCAACACTATGACATGCTGAACTCGAGTTCAGCATGTCATAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1009s1c1
Sequence:CCGGCTATGACATGCTGAAGGACATCTCGAGATGTCCTTCAGCATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-944s1c1
Sequence:CCGGGATTACCGAGTATATGCGGCACTCGAGTGCCGCATATACTCGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1333s1c1
Sequence:CCGGGCTGAAGATGGAACGATCGTTCTCGAGAACGATCGTTCCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-1329s1c1
Sequence:CCGGGATGGCTGAAGATGGAACGATCTCGAGATCGTTCCATCTTCAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018203.1-1711s1c1
Sequence:CCGGCCAAGAATGTCAGCTCCTGTTCTCGAGAACAGGAGCTGACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-883s1c1
Sequence:CCGGCAAGTGGAAGAAGAGGAGCATCTCGAGATGCTCCTCTTCTTCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018203
KLHDC8A MISSION shRNA shRNA Plasmid DNA
kelch domain containing 8A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138761    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018203.1-1842s1c1
Sequence:CCGGGCTGACTCTGAAGAGAGTCTTCTCGAGAAGACTCTCTTCAGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018203.1-2134s1c1
Sequence:CCGGCCTCATCTACTCAGCGAGAATCTCGAGATTCTCGCTGAGTAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1180s1c1
Sequence:CCGGGTTTCCCAACATTCCCTATAACTCGAGTTATAGGGAATGTTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018203.1-2148s1c1
Sequence:CCGGCGAGAATTGGACATGAAGCTACTCGAGTAGCTTCATGTCCAATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-1003s1c1
Sequence:CCGGCCAACACTATGACATGCTGAACTCGAGTTCAGCATGTCATAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1009s1c1
Sequence:CCGGCTATGACATGCTGAAGGACATCTCGAGATGTCCTTCAGCATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-944s1c1
Sequence:CCGGGATTACCGAGTATATGCGGCACTCGAGTGCCGCATATACTCGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1333s1c1
Sequence:CCGGGCTGAAGATGGAACGATCGTTCTCGAGAACGATCGTTCCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-1329s1c1
Sequence:CCGGGATGGCTGAAGATGGAACGATCTCGAGATCGTTCCATCTTCAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018203.1-1711s1c1
Sequence:CCGGCCAAGAATGTCAGCTCCTGTTCTCGAGAACAGGAGCTGACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-883s1c1
Sequence:CCGGCAAGTGGAAGAAGAGGAGCATCTCGAGATGCTCCTCTTCTTCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018203
KLHDC8A MISSION shRNA Lentiviral Transduction Particles
kelch domain containing 8A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138761    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018203.1-1842s1c1
Sequence:CCGGGCTGACTCTGAAGAGAGTCTTCTCGAGAAGACTCTCTTCAGAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018203.1-2134s1c1
Sequence:CCGGCCTCATCTACTCAGCGAGAATCTCGAGATTCTCGCTGAGTAGATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1180s1c1
Sequence:CCGGGTTTCCCAACATTCCCTATAACTCGAGTTATAGGGAATGTTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018203.1-2148s1c1
Sequence:CCGGCGAGAATTGGACATGAAGCTACTCGAGTAGCTTCATGTCCAATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-1003s1c1
Sequence:CCGGCCAACACTATGACATGCTGAACTCGAGTTCAGCATGTCATAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1009s1c1
Sequence:CCGGCTATGACATGCTGAAGGACATCTCGAGATGTCCTTCAGCATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-944s1c1
Sequence:CCGGGATTACCGAGTATATGCGGCACTCGAGTGCCGCATATACTCGGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018203.1-1333s1c1
Sequence:CCGGGCTGAAGATGGAACGATCGTTCTCGAGAACGATCGTTCCATCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-1329s1c1
Sequence:CCGGGATGGCTGAAGATGGAACGATCTCGAGATCGTTCCATCTTCAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018203.1-1711s1c1
Sequence:CCGGCCAAGAATGTCAGCTCCTGTTCTCGAGAACAGGAGCTGACATTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018203.1-883s1c1
Sequence:CCGGCAAGTGGAAGAAGAGGAGCATCTCGAGATGCTCCTCTTCTTCCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks