EMAIL THIS PAGE TO A FRIEND

KLHL30

kelch-like family member 30

UniProtKB ID: Q0D2K2, Q6ZUS1
Gene ID:
Mouse(70788) kelch-like 30
Rat(316624) kelch-like family member 30
domestic guinea pig(100714415) kelch-like family member 30
naked mole-rat(101722309) kelch-like family member 30
sheep(101109583) kelch-like 30 (Drosophila)
Domestic Rabbit(100348959) kelch-like 30 (Drosophila)
Zebrafish(559694) kelch-like 30 (Drosophila)
chicken(424851) kelch-like 30 (Drosophila)
domestic cat(101092632) kelch-like 30 (Drosophila)
cow(100337336) kelch-like 30 (Drosophila)
Horse(100057618) kelch-like 30 (Drosophila)
dog(607240) kelch-like 30 (Drosophila)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198582 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198582 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198582 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014291 MISSION® esiRNA esiRNA targeting human KLHL30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198582 Rosetta Predictions human pricing
XM_001067145 Rosetta Predictions rat pricing
XM_237394 Rosetta Predictions rat pricing
NM_027551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198582 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372220 predicted 848
2 SASI_Hs01_00015957 predicted 1417
3 SASI_Hs02_00372221 predicted 1948
4 SASI_Hs01_00015959 predicted 1289
5 SASI_Hs02_00372222 predicted 1462
6 SASI_Hs02_00372223 predicted 1566
7 SASI_Hs02_00372224 predicted 1573
8 SASI_Hs01_00015961 predicted 937
9 SASI_Hs02_00372225 predicted 848
10 SASI_Hs02_00372226 predicted 543
11 SASI_Hs01_00015958 predicted 858
12 SASI_Hs01_00015960 predicted 854
13 SASI_Hs01_00015962 predicted 264
14 SASI_Hs01_00015963 predicted 229
15 SASI_Hs01_00015964 predicted 1201
16 SASI_Hs01_00015965 predicted 919
17 SASI_Hs01_00015966 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320008 predicted 1638
2 SASI_Rn02_00320009 predicted 1869
3 SASI_Rn02_00320010 predicted 1076
4 SASI_Rn02_00320011 predicted 2038
5 SASI_Rn02_00320012 predicted 1320
6 SASI_Rn02_00320013 predicted 1976
7 SASI_Rn02_00320014 predicted 1534
8 SASI_Rn02_00320015 predicted 1126
9 SASI_Rn02_00320016 predicted 1375
10 SASI_Rn02_00320017 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390877 predicted 1313
2 SASI_Rn02_00390878 predicted 1311
3 SASI_Rn02_00390879 predicted 705
4 SASI_Rn02_00390880 predicted 1124
5 SASI_Rn02_00390881 predicted 289
6 SASI_Rn02_00390882 predicted 659
7 SASI_Rn02_00390883 predicted 1363
8 SASI_Rn02_00390884 predicted 376
9 SASI_Rn02_00390885 predicted 753
10 SASI_Rn02_00390886 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177604 predicted 522
2 SASI_Mm01_00177605 predicted 1311
3 SASI_Mm01_00177606 predicted 1098
4 SASI_Mm01_00177607 predicted 1573
5 SASI_Mm01_00177608 predicted 1622
6 SASI_Mm01_00177609 predicted 317
7 SASI_Mm01_00177610 predicted 1242
8 SASI_Mm01_00177611 predicted 1357
9 SASI_Mm01_00177612 predicted 611
10 SASI_Mm01_00177613 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027551
KLHL30 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 30
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027551.1-2602s1c1
Sequence:CCGGGCTAAGACAGTTCCTCATGTTCTCGAGAACATGAGGAACTGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1572s1c1
Sequence:CCGGGACAACACTAAGAAAGTCTATCTCGAGATAGACTTTCTTAGTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1838s1c1
Sequence:CCGGCAAATGGACACAGCCCTTCATCTCGAGATGAAGGGCTGTGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1487s1c1
Sequence:CCGGGAGTGTCATCGCTTCACCTTTCTCGAGAAAGGTGAAGCGATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027551.1-1556s1c1
Sequence:CCGGCCTGTATCTCATCGGTGACAACTCGAGTTGTCACCGATGAGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027551.1-1629s1c1
Sequence:CCGGCAATCTCAACACAGCCTACATCTCGAGATGTAGGCTGTGTTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027551.1-2867s1c1
Sequence:CCGGCCTGCCAATCATGATATGATTCTCGAGAATCATATCATGATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027551
KLHL30 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 30
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027551.1-2602s1c1
Sequence:CCGGGCTAAGACAGTTCCTCATGTTCTCGAGAACATGAGGAACTGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1572s1c1
Sequence:CCGGGACAACACTAAGAAAGTCTATCTCGAGATAGACTTTCTTAGTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1838s1c1
Sequence:CCGGCAAATGGACACAGCCCTTCATCTCGAGATGAAGGGCTGTGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1487s1c1
Sequence:CCGGGAGTGTCATCGCTTCACCTTTCTCGAGAAAGGTGAAGCGATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027551.1-1556s1c1
Sequence:CCGGCCTGTATCTCATCGGTGACAACTCGAGTTGTCACCGATGAGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027551.1-1629s1c1
Sequence:CCGGCAATCTCAACACAGCCTACATCTCGAGATGTAGGCTGTGTTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027551.1-2867s1c1
Sequence:CCGGCCTGCCAATCATGATATGATTCTCGAGAATCATATCATGATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027551
KLHL30 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 30
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027551.1-2602s1c1
Sequence:CCGGGCTAAGACAGTTCCTCATGTTCTCGAGAACATGAGGAACTGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1572s1c1
Sequence:CCGGGACAACACTAAGAAAGTCTATCTCGAGATAGACTTTCTTAGTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1838s1c1
Sequence:CCGGCAAATGGACACAGCCCTTCATCTCGAGATGAAGGGCTGTGTCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027551.1-1487s1c1
Sequence:CCGGGAGTGTCATCGCTTCACCTTTCTCGAGAAAGGTGAAGCGATGACACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027551.1-1556s1c1
Sequence:CCGGCCTGTATCTCATCGGTGACAACTCGAGTTGTCACCGATGAGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027551.1-1629s1c1
Sequence:CCGGCAATCTCAACACAGCCTACATCTCGAGATGTAGGCTGTGTTGAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027551.1-2867s1c1
Sequence:CCGGCCTGCCAATCATGATATGATTCTCGAGAATCATATCATGATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198582
KLHL30 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 30
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-1202s1c1
Sequence:CCGGCCCTCAAATACGTCAGCAACTCTCGAGAGTTGCTGACGTATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-3275s1c1
Sequence:CCGGCCCAAAGTGCTGGGATTACAACTCGAGTTGTAATCCCAGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-2491s1c1
Sequence:CCGGGTCAGAACAAAGGCTCTTCATCTCGAGATGAAGAGCCTTTGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-3137s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198582.3-1117s21c1
Sequence:CCGGCAAAGACAGACACCTGGTCAACTCGAGTTGACCAGGTGTCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198582.3-985s21c1
Sequence:CCGGGGAACTTTGCCTTCTACAACACTCGAGTGTTGTAGAAGGCAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198582
KLHL30 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 30
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-1202s1c1
Sequence:CCGGCCCTCAAATACGTCAGCAACTCTCGAGAGTTGCTGACGTATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-3275s1c1
Sequence:CCGGCCCAAAGTGCTGGGATTACAACTCGAGTTGTAATCCCAGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-2491s1c1
Sequence:CCGGGTCAGAACAAAGGCTCTTCATCTCGAGATGAAGAGCCTTTGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-3137s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198582.3-1117s21c1
Sequence:CCGGCAAAGACAGACACCTGGTCAACTCGAGTTGACCAGGTGTCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198582.3-985s21c1
Sequence:CCGGGGAACTTTGCCTTCTACAACACTCGAGTGTTGTAGAAGGCAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198582
KLHL30 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 30
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-1202s1c1
Sequence:CCGGCCCTCAAATACGTCAGCAACTCTCGAGAGTTGCTGACGTATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-3275s1c1
Sequence:CCGGCCCAAAGTGCTGGGATTACAACTCGAGTTGTAATCCCAGCACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153373    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-2491s1c1
Sequence:CCGGGTCAGAACAAAGGCTCTTCATCTCGAGATGAAGAGCCTTTGTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198582.1-3137s1c1
Sequence:CCGGCCTCTCAAGTAGCTGGGATTACTCGAGTAATCCCAGCTACTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198582.3-1117s21c1
Sequence:CCGGCAAAGACAGACACCTGGTCAACTCGAGTTGACCAGGTGTCTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198582.3-985s21c1
Sequence:CCGGGGAACTTTGCCTTCTACAACACTCGAGTGTTGTAGAAGGCAAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks