EMAIL THIS PAGE TO A FRIEND

KLHL33

kelch-like family member 33

UniProtKB ID: A6NCF5
Gene ID:
Mouse(546611) kelch-like 33
Rat(100362676) kelch-like family member 33
domestic cat(101100817) kelch-like 33 (Drosophila)
dog(482556) kelch-like 33 (Drosophila)
cow(100141057) kelch-like 33 (Drosophila)
sheep(101115711) kelch-like 33 (Drosophila)
domestic guinea pig(100719621) kelch-like family member 33
naked mole-rat(101712002) kelch-like family member 33
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001109997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001109997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001109997 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001109997 Rosetta Predictions human pricing
XM_001714708 Rosetta Predictions human pricing
XM_001716896 Rosetta Predictions human pricing
XM_063481 Rosetta Predictions human pricing
XM_939570 Rosetta Predictions human pricing
XM_621372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324833 predicted 590
2 SASI_Hs02_00324834 predicted 949
3 SASI_Hs02_00324835 predicted 1051
4 SASI_Hs02_00324836 predicted 1043
5 SASI_Hs02_00324837 predicted 998
6 SASI_Hs02_00324838 predicted 1060
7 SASI_Hs02_00324839 predicted 420
8 SASI_Hs02_00324840 predicted 336
9 SASI_Hs02_00324841 predicted 550
10 SASI_Hs02_00324842 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00398875 predicted 1692
2 SASI_Hs02_00398876 predicted 692
3 SASI_Hs02_00398877 predicted 665
4 SASI_Hs02_00398878 predicted 2151
5 SASI_Hs02_00398879 predicted 607
6 SASI_Hs02_00398880 predicted 1872
7 SASI_Hs02_00398881 predicted 1519
8 SASI_Hs02_00398882 predicted 1226
9 SASI_Hs02_00398883 predicted 1169
10 SASI_Hs02_00398884 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00413666 predicted 2042
2 SASI_Hs02_00413667 predicted 2043
3 SASI_Hs02_00413668 predicted 2150
4 SASI_Hs02_00413669 predicted 2135
5 SASI_Hs02_00413670 predicted 2094
6 SASI_Hs02_00413671 predicted 2161
7 SASI_Hs02_00413672 predicted 2151
8 SASI_Hs02_00413673 predicted 2081
9 SASI_Hs02_00413674 predicted 1325
10 SASI_Hs02_00413675 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_063481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280328 predicted 657
2 SASI_Hs01_00280329 predicted 1067
3 SASI_Hs01_00280330 predicted 1074
4 SASI_Hs01_00280331 predicted 489
5 SASI_Hs01_00280332 predicted 970
6 SASI_Hs01_00280333 predicted 616
7 SASI_Hs01_00280334 predicted 616
8 SASI_Hs01_00280335 predicted 1050
9 SASI_Hs01_00280336 predicted 669
10 SASI_Hs01_00280337 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483689 predicted 1690
2 SASI_Hs02_00483690 predicted 692
3 SASI_Hs02_00483691 predicted 668
4 SASI_Hs02_00483692 predicted 2146
5 SASI_Hs02_00483693 predicted 609
6 SASI_Hs02_00483694 predicted 1878
7 SASI_Hs02_00483695 predicted 1517
8 SASI_Hs02_00483696 predicted 1228
9 SASI_Hs02_00483697 predicted 1172
10 SASI_Hs02_00483698 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246945 predicted 1023
2 SASI_Mm01_00246946 predicted 379
3 SASI_Mm01_00246947 predicted 1099
4 SASI_Mm01_00246948 predicted 347
5 SASI_Mm01_00246949 predicted 222
6 SASI_Mm01_00246950 predicted 1104
7 SASI_Mm01_00246951 predicted 985
8 SASI_Mm01_00246952 predicted 1309
9 SASI_Mm01_00246953 predicted 849
10 SASI_Mm01_00246954 predicted 844
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001109997
KLHL33 MISSION shRNA Bacterial Glycerol Stock
kelch-like family member 33
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1004s21c1
Sequence:CCGGCATTGGGTGGGAGGTTGTATGCTCGAGCATACAACCTCCCACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1062s21c1
Sequence:CCGGCTTTGAGGCCTATGAACTAAGCTCGAGCTTAGTTCATAGGCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1174s21c1
Sequence:CCGGGGCTACAGTCACCGTACTTATCTCGAGATAAGTACGGTGACTGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-782s21c1
Sequence:CCGGCCTACAACCCTGAGCTCAATGCTCGAGCATTGAGCTCAGGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-911s21c1
Sequence:CCGGTGGCCTCACTGATGCACTATGCTCGAGCATAGTGCATCAGTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001109997
KLHL33 MISSION shRNA shRNA Plasmid DNA
kelch-like family member 33
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1004s21c1
Sequence:CCGGCATTGGGTGGGAGGTTGTATGCTCGAGCATACAACCTCCCACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1062s21c1
Sequence:CCGGCTTTGAGGCCTATGAACTAAGCTCGAGCTTAGTTCATAGGCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1174s21c1
Sequence:CCGGGGCTACAGTCACCGTACTTATCTCGAGATAAGTACGGTGACTGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-782s21c1
Sequence:CCGGCCTACAACCCTGAGCTCAATGCTCGAGCATTGAGCTCAGGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-911s21c1
Sequence:CCGGTGGCCTCACTGATGCACTATGCTCGAGCATAGTGCATCAGTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001109997
KLHL33 MISSION shRNA Lentiviral Transduction Particles
kelch-like family member 33
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1004s21c1
Sequence:CCGGCATTGGGTGGGAGGTTGTATGCTCGAGCATACAACCTCCCACCCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1062s21c1
Sequence:CCGGCTTTGAGGCCTATGAACTAAGCTCGAGCTTAGTTCATAGGCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-1174s21c1
Sequence:CCGGGGCTACAGTCACCGTACTTATCTCGAGATAAGTACGGTGACTGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-782s21c1
Sequence:CCGGCCTACAACCCTGAGCTCAATGCTCGAGCATTGAGCTCAGGGTTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001109997.1-911s21c1
Sequence:CCGGTGGCCTCACTGATGCACTATGCTCGAGCATAGTGCATCAGTGAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks