EMAIL THIS PAGE TO A FRIEND

KLK13

kallikrein-related peptidase 13

Synonyms: KLK-L4 KLKL4
UniProtKB ID: Q9UKR3, A7UNK6, Q9Y433
Gene ID:
Human(26085) Summary: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has been identified, but its full length sequence has not been determined. [provided by RefSeq, Jul 2008]
Mouse(626834) kallikrein related-peptidase 13
Rat(292848) kallikrein related-peptidase 13
dog(484349) kallikrein-related peptidase 13
sheep(101120106) kallikrein-related peptidase 13
domestic guinea pig(100715865) kallikrein-related peptidase 13
naked mole-rat(101704794) kallikrein-related peptidase 13
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015596 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001039042 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039042 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039042 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU174101 MISSION® esiRNA esiRNA targeting mouse Klk13 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015596 Rosetta Predictions human pricing
XM_001080409 Rosetta Predictions rat pricing
XM_218643 Rosetta Predictions rat pricing
NM_001039042 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012444 predicted 972
2 SASI_Hs01_00012445 predicted 709
3 SASI_Hs01_00012446 predicted 337
4 SASI_Hs01_00012447 predicted 1001
5 SASI_Hs01_00012448 predicted 889
6 SASI_Hs01_00012449 predicted 779
7 SASI_Hs01_00012450 predicted 1006
8 SASI_Hs01_00012452 predicted 277
9 SASI_Hs01_00012453 predicted 614
10 SASI_Hs02_00348177 predicted 592
11 SASI_Hs01_00012451 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367919 predicted 784
2 SASI_Rn02_00367920 predicted 755
3 SASI_Rn02_00367921 predicted 270
4 SASI_Rn02_00367922 predicted 425
5 SASI_Rn02_00367923 predicted 228
6 SASI_Rn02_00367924 predicted 586
7 SASI_Rn02_00367925 predicted 409
8 SASI_Rn02_00367926 predicted 402
9 SASI_Rn02_00367927 predicted 551
10 SASI_Rn02_00367928 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377923 predicted 781
2 SASI_Rn02_00377924 predicted 758
3 SASI_Rn02_00377925 predicted 264
4 SASI_Rn02_00377926 predicted 431
5 SASI_Rn02_00377927 predicted 227
6 SASI_Rn02_00377928 predicted 582
7 SASI_Rn02_00377929 predicted 414
8 SASI_Rn02_00377930 predicted 400
9 SASI_Rn02_00377931 predicted 547
10 SASI_Rn02_00377932 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039042 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053212 predicted 777
2 SASI_Mm01_00053213 predicted 418
3 SASI_Mm02_00289726 predicted 251
4 SASI_Mm01_00053214 predicted 474
5 SASI_Mm01_00053215 predicted 748
6 SASI_Mm01_00053216 predicted 530
7 SASI_Mm01_00053217 predicted 748
8 SASI_Mm01_00053218 predicted 590
9 SASI_Mm02_00289727 predicted 264
10 SASI_Mm01_00053220 predicted 406
11 SASI_Mm01_00053219 predicted 410
12 SASI_Mm01_00053221 predicted 586
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015596
KLK13 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-622s1c1
Sequence:CCGGCCCAGGAAAGATCACTGACAACTCGAGTTGTCAGTGATCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-404s1c1
Sequence:CCGGCACGACCATGACATCATGCTTCTCGAGAAGCATGATGTCATGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-710s1c1
Sequence:CCGGGTCTGTAACAGAACACTGTATCTCGAGATACAGTGTTCTGTTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-286s1c1
Sequence:CCGGGCTCAAAGTTTACCTAGGCAACTCGAGTTGCCTAGGTAAACTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-814s1c1
Sequence:CCGGGATCCGTGAAACAATCCGAAACTCGAGTTTCGGATTGTTTCACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015596.1-1000s21c1
Sequence:CCGGGCTCAATCTCAGCTAACATTCCTCGAGGAATGTTAGCTGAGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015596.1-858s21c1
Sequence:CCGGGGTTGAAGGGCCCACAATAAACTCGAGTTTATTGTGGGCCCTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015596.1-260s21c1
Sequence:CCGGACTGCCGCACACTGTCTAAAGCTCGAGCTTTAGACAGTGTGCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015596
KLK13 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-622s1c1
Sequence:CCGGCCCAGGAAAGATCACTGACAACTCGAGTTGTCAGTGATCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-404s1c1
Sequence:CCGGCACGACCATGACATCATGCTTCTCGAGAAGCATGATGTCATGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-710s1c1
Sequence:CCGGGTCTGTAACAGAACACTGTATCTCGAGATACAGTGTTCTGTTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-286s1c1
Sequence:CCGGGCTCAAAGTTTACCTAGGCAACTCGAGTTGCCTAGGTAAACTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-814s1c1
Sequence:CCGGGATCCGTGAAACAATCCGAAACTCGAGTTTCGGATTGTTTCACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015596.1-1000s21c1
Sequence:CCGGGCTCAATCTCAGCTAACATTCCTCGAGGAATGTTAGCTGAGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015596.1-858s21c1
Sequence:CCGGGGTTGAAGGGCCCACAATAAACTCGAGTTTATTGTGGGCCCTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015596.1-260s21c1
Sequence:CCGGACTGCCGCACACTGTCTAAAGCTCGAGCTTTAGACAGTGTGCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015596
KLK13 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-622s1c1
Sequence:CCGGCCCAGGAAAGATCACTGACAACTCGAGTTGTCAGTGATCTTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-404s1c1
Sequence:CCGGCACGACCATGACATCATGCTTCTCGAGAAGCATGATGTCATGGTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-710s1c1
Sequence:CCGGGTCTGTAACAGAACACTGTATCTCGAGATACAGTGTTCTGTTACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-286s1c1
Sequence:CCGGGCTCAAAGTTTACCTAGGCAACTCGAGTTGCCTAGGTAAACTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015596.1-814s1c1
Sequence:CCGGGATCCGTGAAACAATCCGAAACTCGAGTTTCGGATTGTTTCACGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372697    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015596.1-1000s21c1
Sequence:CCGGGCTCAATCTCAGCTAACATTCCTCGAGGAATGTTAGCTGAGATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015596.1-858s21c1
Sequence:CCGGGGTTGAAGGGCCCACAATAAACTCGAGTTTATTGTGGGCCCTTCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015596.1-260s21c1
Sequence:CCGGACTGCCGCACACTGTCTAAAGCTCGAGCTTTAGACAGTGTGCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039042
KLK13 MISSION shRNA Bacterial Glycerol Stock
kallikrein-related peptidase 13
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000265663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-536s21c1
Sequence:CCGGTGAACCACGACCATGACATCACTCGAGTGATGTCATGGTCGTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-213s21c1
Sequence:CCGGCTTGGCCTTGTCCGAAGGAATCTCGAGATTCCTTCGGACAAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-599s21c1
Sequence:CCGGTCCGTACCCTGAAACTCTCTGCTCGAGCAGAGAGTTTCAGGGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-856s21c1
Sequence:CCGGGGCAAACTCTACGGCATCATCCTCGAGGATGATGCCGTAGAGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039042
KLK13 MISSION shRNA shRNA Plasmid DNA
kallikrein-related peptidase 13
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000265663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-536s21c1
Sequence:CCGGTGAACCACGACCATGACATCACTCGAGTGATGTCATGGTCGTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-213s21c1
Sequence:CCGGCTTGGCCTTGTCCGAAGGAATCTCGAGATTCCTTCGGACAAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-599s21c1
Sequence:CCGGTCCGTACCCTGAAACTCTCTGCTCGAGCAGAGAGTTTCAGGGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-856s21c1
Sequence:CCGGGGCAAACTCTACGGCATCATCCTCGAGGATGATGCCGTAGAGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039042
KLK13 MISSION shRNA Lentiviral Transduction Particles
kallikrein-related peptidase 13
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000265663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-536s21c1
Sequence:CCGGTGAACCACGACCATGACATCACTCGAGTGATGTCATGGTCGTGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-213s21c1
Sequence:CCGGCTTGGCCTTGTCCGAAGGAATCTCGAGATTCCTTCGGACAAGGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-599s21c1
Sequence:CCGGTCCGTACCCTGAAACTCTCTGCTCGAGCAGAGAGTTTCAGGGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039042.2-856s21c1
Sequence:CCGGGGCAAACTCTACGGCATCATCCTCGAGGATGATGCCGTAGAGTTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks